Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 1 1
Psychromonas sp. CNPT3
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449 7 1
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -9
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: ASA_P4G088: Mercury uptake inner membane protein
 
Tolumonas auensis DSM 9187
Mercury uptake inner membane protein
merP
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_P4G089: Periplasmic mercury(+2) binding protein
 
Tolumonas auensis DSM 9187
Periplasmic mercury(+2) binding protein
merC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_P4G090: Mercury uptake inner membane protein
 
Tolumonas auensis DSM 9187
Mercury uptake inner membane protein
merA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_P4G091: Mercuric ion reductase (EC 1.16.1.1)
 
Tolumonas auensis DSM 9187
Mercuric ion reductase (EC 1.16.1.1)
merD
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_P4G092: Mercuric resistance operon coregulator
 
Tolumonas auensis DSM 9187
Mercuric resistance operon coregulator
merE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_P4G093: Putative mercury resistance protein
 
Tolumonas auensis DSM 9187
Putative mercury resistance protein
PF00563
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_P4G094: Diguanylate phosphodiesterase, EAL domain
 
Tolumonas auensis DSM 9187
Diguanylate phosphodiesterase, EAL domain
 
CRON 2.
merP
*
Psychromonas ingrahamii 37

Site:
position = -358
score = 5.66749
sequence = ACTCCCTACTTGGGTACGGCAT

Gene: Ping_1945: Periplasmic mercury(+2) binding protein
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Periplasmic mercury(+2) binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD