Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype' 10 4
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145 3 1
Idiomarina loihiensis L2TR 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
merT4
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -61
score = 5.15614
sequence = ACAGCGTACATTAGTACGGCAT

Gene: MADE_02957: Mercury uptake inner membane protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mercury uptake inner membane protein
 
CRON 2.
merT2
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -83
score = 4.99202
sequence = ACTCCGTACTTAGGTACATGCA

Gene: MADE_01411: Mercury uptake inner membane protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mercury uptake inner membane protein
merP2
 
Pseudoalteromonas atlantica T6c
 2
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02043: Periplasmic mercury(+2) binding protein

Gene: MADE_01410: Periplasmic mercury(+2) binding protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Periplasmic mercury(+2) binding protein
merC2
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01409: Mercury uptake inner membane protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mercury uptake inner membane protein
merA2
 
Pseudoalteromonas atlantica T6c
 2
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01408: Mercuric ion reductase (EC 1.16.1.1)

Gene: MADE_02044: Mercuric ion reductase (EC 1.16.1.1)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mercuric ion reductase (EC 1.16.1.1)
merD2
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01407: Mercuric resistance operon coregulator
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mercuric resistance operon coregulator
 
CRON 3.
merT3
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -149
score = 5.29407
sequence = ACTCGGTACCACGGTACTGAGT

Gene: MADE_02959: Mercury uptake inner membane protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Mercury uptake inner membane protein
merP3
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02958: Periplasmic mercury(+2) binding protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Periplasmic mercury(+2) binding protein
 
CRON 4.
merT
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -66
score = 5.06231
sequence = CTTCCGTAGTGAGGTACGGGTC

Gene: OS145_03813: Mercury uptake inner membane protein
*
Idiomarina loihiensis L2TR

Site:
position = -66
score = 5.30676
sequence = CTTCCGTAGTGAGGTACGGGTT

Gene: IL1644: Mercury uptake inner membane protein
Mercury uptake inner membane protein
merP
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_03818: Periplasmic mercury(+2) binding protein
 
Idiomarina loihiensis L2TR

Gene: IL1645: Periplasmic mercury(+2) binding protein
Periplasmic mercury(+2) binding protein
merA
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -10
score = 6.09032
sequence = ACTCCGTACAATGGTACGGCGT

Gene: MADE_02949: Mercuric ion reductase (EC 1.16.1.1)
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145

Gene: OS145_03823: Mercuric ion reductase (EC 1.16.1.1)
 
Idiomarina loihiensis L2TR

Gene: IL1646: Mercuric ion reductase (EC 1.16.1.1)
Mercuric ion reductase (EC 1.16.1.1)
merB
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_02948: Organomercurial lyase
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Organomercurial lyase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD