Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MerR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000
Ralstonia pickettii 12J 6 1
Ralstonia metallidurans CH34 25 7
Ralstonia eutropha JMP134 10 2
Ralstonia eutropha H16 2 1
Cupriavidus taiwanensis
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
h16_B0904
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
*
Ralstonia eutropha H16

Site:
position = -142
score = 6.26364
sequence = ACTCCGTACCTTGGTACGGACC

Gene: H16_B0904: hypothetical protein
 
Cupriavidus taiwanensis
hypothetical protein
h16_B0905
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_B0905: hypothetical protein
 
Cupriavidus taiwanensis
hypothetical protein
 
CRON 2.
merT
 
Ralstonia solanacearum GMI1000
*
Ralstonia pickettii 12J

Site:
position = -63
score = 6.06052
sequence = ACTCCGTACAACAGTACGGAAG

Gene: Rpic_1784: Mercury uptake inner membane protein
*4
Ralstonia metallidurans CH34

Site:
position = -63
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: Rmet_6172: Mercury uptake inner membane protein

Site:
position = -63
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: Rmet_6345: Mercury uptake inner membane protein

Site:
position = -63
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: pMOL30_107: Mercury uptake inner membane protein

Site:
position = -63
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: RMe0107: Mercury uptake inner membane protein
*2
Ralstonia eutropha JMP134

Site:
position = -63
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: Reut_D6497: Mercury uptake inner membane protein

Site:
position = -63
score = 6.32826
sequence = ACTCCGTACATGAGTACGGAAG

Gene: pJP4_52: Mercury uptake inner membane protein
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Mercury uptake inner membane protein
merP
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_1785: Periplasmic mercury (+2) binding protein
 4
Ralstonia metallidurans CH34

Gene: Rmet_6173: Periplasmic mercury (+2) binding protein

Gene: Rmet_6346: Periplasmic mercury (+2) binding protein

Gene: pMOL30_106: Periplasmic mercury (+2) binding protein

Gene: RMe0106: Periplasmic mercury (+2) binding protein
 2
Ralstonia eutropha JMP134

Gene: Reut_D6496: Periplasmic mercury (+2) binding protein

Gene: pJP4_51: Periplasmic mercury (+2) binding protein
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Periplasmic mercury (+2) binding protein
merC
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_1786: Mercury uptake inner membane protein
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Mercury uptake inner membane protein
merA
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_1787: Mercuric ion reductase (EC 1.16.1.1)
 4
Ralstonia metallidurans CH34

Gene: Rmet_6183: Mercuric ion reductase (EC 1.16.1.1)

Gene: Rmet_6174: Mercuric ion reductase (EC 1.16.1.1)

Gene: pMOL30_105: Mercuric ion reductase (EC 1.16.1.1)

Gene: RMe0105: Mercuric ion reductase (EC 1.16.1.1)
 2
Ralstonia eutropha JMP134

Gene: Reut_D6495: Mercuric ion reductase (EC 1.16.1.1)

Gene: pJP4_50: Mercuric ion reductase (EC 1.16.1.1)
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Mercuric ion reductase (EC 1.16.1.1)
merD
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_1788: Mercuric resistance operon coregulator
 4
Ralstonia metallidurans CH34

Gene: Rmet_6175: Mercuric resistance operon coregulator

Gene: Rmet_6184: Mercuric resistance operon coregulator

Gene: pMOL30_104: Mercuric resistance operon coregulator

Gene: RMe0104: Mercuric resistance operon coregulator
 2
Ralstonia eutropha JMP134

Gene: Reut_D6494: Mercuric resistance operon coregulator

Gene: pJP4_49: Mercuric resistance operon coregulator
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Mercuric resistance operon coregulator
merB
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_1789: Organomercurial lyase
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Organomercurial lyase
merE
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 4
Ralstonia metallidurans CH34

Gene: Rmet_6176: Putative mercury resistance protein

Gene: Rmet_6185: Putative mercury resistance protein

Gene: pMOL30_103: Putative mercury resistance protein

Gene: RMe0103: Putative mercury resistance protein
 2
Ralstonia eutropha JMP134

Gene: pJP4_48: Putative mercury resistance protein

Gene: Reut_D6493: Putative mercury resistance protein
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Putative mercury resistance protein
 
CRON 3.
merT
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*3
Ralstonia metallidurans CH34

Site:
position = -62
score = 6.32283
sequence = ACTCCGTACTCAGGTACGGGAT

Gene: Rmet_5991: Mercuric transport protein, MerT

Site:
position = -63
score = 6.17332
sequence = ACTCCGTAGTTGACTACGGAAG

Gene: Rmet_2313: Mercuric transport protein, MerT

Site:
position = -62
score = 6.32283
sequence = ACTCCGTACTCAGGTACGGGAT

Gene: pMOL30_053: Mercuric transport protein, MerT
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Mercuric transport protein, MerT
merP
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 2
Ralstonia metallidurans CH34

Gene: pMOL30_052: Periplasmic mercury (+2) binding protein

Gene: Rmet_2314: Periplasmic mercury (+2) binding protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Periplasmic mercury (+2) binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD