Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756
Caulobacter sp. K31 4 3
Phenylobacterium zucineum HLK1 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copA
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -56
score = 5.63722
sequence = ACCTTCCCATGATGGGAGGGA

Gene: Caul_2317: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Phenylobacterium zucineum HLK1

Site:
position = -59
score = 5.14251
sequence = ACCCTCCCATGGTGGGAAACT

Gene: PHZ_c1469: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -59
score = 6.00829
sequence = ACCCTCCCATCATGGGAAGGT

Gene: PHZ_p0211: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_2318: Copper-responsive transcriptional regulator, MerR family
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_c1468: Copper-responsive transcriptional regulator, MerR family

Gene: PHZ_p0210: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
copC
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2515: Copper resistance protein
 
Caulobacter sp. K31

Gene: Caul_2347: Copper resistance protein
*2
Phenylobacterium zucineum HLK1

Gene: PHZ_p0225: Copper resistance protein

Site:
position = -129
score = 6.14697
sequence = ACCTTCCCACTATTGGAAGGT

Gene: PHZ_c1481: Copper resistance protein
Copper resistance protein
copD
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_2516: Putative copper export protein
 
Caulobacter sp. K31

Gene: Caul_2346: Putative copper export protein
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_c1480: Putative copper export protein

Gene: PHZ_p0224: Putative copper export protein
Putative copper export protein
 
CRON 3.
cueO
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -42
score = 5.04308
sequence = TCCTTCCCATCATTGGAATCT

Gene: Caul_2311: Multicopper oxidase
 
Phenylobacterium zucineum HLK1
Multicopper oxidase
 
CRON 4.
copZ
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -28
score = 5.46701
sequence = ACCTTGCCATGATGGGAAGCC

Gene: Caul_2321: Copper chaperone
*
Phenylobacterium zucineum HLK1

Site:
position = -41
score = 5.62722
sequence = ACCCTCCCACTGTGGGAAGCT

Gene: PHZ_c1479: Copper chaperone
Copper chaperone
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD