Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444 3 1
Sphingopyxis alaskensis RB2256
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copA
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -53
score = 5.12449
sequence = ACCCTGACATGATGTCAAGGT

Gene: Saro_2142: Copper-translocating P-type ATPase (EC 3.6.3.4)
 3
Sphingopyxis alaskensis RB2256

Gene: Sala_2453: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: Sala_2429: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: Sala_2544: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Sphingobium japonicum UT26S

Gene: SJA_C1-04830: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Copper-translocating P-type ATPase (EC 3.6.3.4)
PF11666
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2143: hypothetical protein
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S

Gene: SJA_C1-04760: hypothetical protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
hypothetical protein
cueR
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2144: Copper-responsive transcriptional regulator, MerR family
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2543: Copper-responsive transcriptional regulator, MerR family
 
Sphingobium japonicum UT26S

Gene: SJA_C1-04820: Copper-responsive transcriptional regulator, MerR family
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Copper-responsive transcriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD