Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1 5 4
Magnetospirillum magneticum AMB-1 3 2
Azospirillum sp. B510 2 1
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ2
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -58
score = 5.40546
sequence = ACCTTCCCACCATGGGAACGA

Gene: Magn03006555: Copper chaperone
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Copper chaperone
 
CRON 2.
copA
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1894: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -60
score = 5.79722
sequence = ACCTTCCAGTGACTGGAAGGT

Gene: Magn03009759: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Magnetospirillum magneticum AMB-1

Site:
position = -26
score = 5.89365
sequence = ACCTTCCCGTTGCTGGAAGGT

Gene: amb1807: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Azospirillum sp. B510

Site:
position = -62
score = 4.90964
sequence = ACCTTCCAGCGGCTGGAAGCC

Gene: AZL_a03850: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_2089: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009758: Copper-responsive transcriptional regulator, MerR family
 
Magnetospirillum magneticum AMB-1

Gene: amb1808: Copper-responsive transcriptional regulator, MerR family
 
Azospirillum sp. B510

Gene: AZL_a03860: Copper-responsive transcriptional regulator, MerR family
 
Rhodospirillum centenum SW

Gene: RC1_0106: Copper-responsive transcriptional regulator, MerR family
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_2090: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 3.
copA2
 
Rhodospirillum rubrum ATCC 11170
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -127
score = 5.08284
sequence = ACCTTCCCATTGTAGGAAGCC

Gene: Magn03006556: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Copper-translocating P-type ATPase (EC 3.6.3.4)
 
CRON 4.
copZ
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1892: Copper chaperone
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -61
score = 5.48208
sequence = ACCTTCCATCGGCTGGAAGGT

Gene: Magn03009756: Copper chaperone
*
Magnetospirillum magneticum AMB-1

Site:
position = -61
score = 5.19423
sequence = ACCTTCCATGGGCTGGAAGGT

Gene: amb1810: Copper chaperone
 
Azospirillum sp. B510

Gene: AZL_015970: Copper chaperone
 
Rhodospirillum centenum SW

Gene: RC1_0108: Copper chaperone
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Copper chaperone
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD