Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1 3 2
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1 2 1
Rhodobacterales bacterium HTCC2654 2 2
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597 3 2
Roseovarius nubinhibens ISM 2 2
Roseovarius sp. 217 10 5
Sulfitobacter sp. EE-36 2 1
Silicibacter TM1040
Silicibacter pomeroyi DSS-3 2 1
Roseobacter sp. MED193 4 2
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -123
score = 5.30264
sequence = GGCTTCCCACAACTGGAAGGT

Gene: RSP_2891: Copper chaperone
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*2
Rhodobacterales bacterium HTCC2654

Site:
position = -104
score = 5.27286
sequence = CCCTTCCAGTCACTGGAAGGT

Gene: RB2654_14810: Copper chaperone

Site:
position = -60
score = 5.10873
sequence = ACCTTCCAGCGGGGGGAAGCC

Gene: RB2654_22238: Copper chaperone
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_00015: Copper chaperone
*
Oceanicola batsensis HTCC2597

Site:
position = -60
score = 5.10873
sequence = ACCTTCCAGCGGGGGGAAGCC

Gene: OB2597_16482: Copper chaperone
*
Roseovarius nubinhibens ISM

Site:
position = -51
score = 5.1372
sequence = ACCTTCCCATAGGGGGACGGC

Gene: ISM_17460: Copper chaperone
*
Roseovarius sp. 217

Site:
position = -103
score = 5.0862
sequence = GGCTTCCACCAACTGGAAGGT

Gene: ROS217_03390: Copper chaperone
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Copper chaperone
 
CRON 2.
copA
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -48
score = 5.30264
sequence = ACCTTCCAGTTGTGGGAAGCC

Gene: RSP_2890: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Paracoccus denitrificans PD1222

Gene: Pden_0521: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Jannaschia sp. CCS1

Site:
position = -54
score = 5.54911
sequence = AGCTTCCAGTCACTGGAAGGT

Gene: Jann_2086: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14850: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_15329: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_00020: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Oceanicola batsensis HTCC2597

Site:
position = -58
score = 4.78538
sequence = ACCCTCCAGTAACTGGAAGCC

Gene: OB2597_16487: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Roseovarius nubinhibens ISM

Site:
position = -128
score = 5.03155
sequence = ACCTTCCAGTTGCTGGAAGCC

Gene: ISM_17435: Copper-translocating P-type ATPase (EC 3.6.3.4)
*3
Roseovarius sp. 217

Site:
position = -55
score = 5.0862
sequence = ACCTTCCAGTTGGTGGAAGCC

Gene: ROS217_03395: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -192
score = 4.3433
sequence = ACCTTACAGTGACTGGAATCC

Gene: ROS217_07749: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -61
score = 4.76169
sequence = ACCTTCCAGTTACAGGAACCT

Gene: ROS217_02315: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Sulfitobacter sp. EE-36

Site:
position = -114
score = 4.97128
sequence = ACCTTCCATTAACTGGAAGCC

Gene: EE36_05438: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Silicibacter TM1040

Gene: TM1040_2080: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Silicibacter pomeroyi DSS-3

Site:
position = -58
score = 4.74607
sequence = ACCTTCCCGTGACTGGAACCC

Gene: SPO0794: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Roseobacter sp. MED193

Site:
position = -62
score = 4.98447
sequence = ACCTTCCCCTAACTGGAGGCC

Gene: MED193_18159: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -36
score = 4.68391
sequence = ACCTTCCGGTAACTGGAAGCC

Gene: MED193_02420: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2889: Copper-responsive transcriptional regulator, MerR family
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2087: Copper-responsive transcriptional regulator, MerR family
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14855: Copper-responsive transcriptional regulator, MerR family
 
Oceanicola granulosus HTCC2516

Gene: OG2516_15334: Copper-responsive transcriptional regulator, MerR family
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_16492: Copper-responsive transcriptional regulator, MerR family
 
Roseovarius nubinhibens ISM
*4
Roseovarius sp. 217

Gene: ROS217_07754: Copper-responsive transcriptional regulator, MerR family

Site:
position = -49
score = 5.23292
sequence = ACCTTCCATCTACTGGAAGGA

Gene: ROS217_02505: Copper-responsive transcriptional regulator, MerR family

Gene: ROS217_02320: Copper-responsive transcriptional regulator, MerR family

Gene: ROS217_03400: Copper-responsive transcriptional regulator, MerR family
 
Sulfitobacter sp. EE-36

Gene: EE36_05433: Copper-responsive transcriptional regulator, MerR family
 
Silicibacter TM1040

Gene: TM1040_0537: Copper-responsive transcriptional regulator, MerR family
 
Silicibacter pomeroyi DSS-3

Gene: SPO0793: Copper-responsive transcriptional regulator, MerR family
 2
Roseobacter sp. MED193

Gene: MED193_02425: Copper-responsive transcriptional regulator, MerR family

Gene: MED193_18164: Copper-responsive transcriptional regulator, MerR family
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Copper-responsive transcriptional regulator, MerR family
PF07885
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_03405: Hypothetical membrane protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Hypothetical membrane protein
ROS217_02325
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_02325: hypothetical protein
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD