Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 12 5
Rhizobium sp. NGR234 14 5
Rhizobium leguminosarum bv. viciae 3841 4 2
Rhizobium etli CFN 42 2 1
Agrobacterium tumefaciens str. C58 (Cereon) 5 2
Mesorhizobium sp. BNC1 5 3
Mesorhizobium loti MAFF303099 1 1
Brucella melitensis 16M 2 2
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copA
*2
Sinorhizobium meliloti 1021

Site:
position = -55
score = 5.86085
sequence = ACCTTCCCATTATTGGAAGGA

Gene: SMb21578: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -57
score = 5.57237
sequence = ACCTTACCATTGTTGGAAGGA

Gene: SMa1013: Copper-translocating P-type ATPase (EC 3.6.3.4)
*3
Rhizobium sp. NGR234

Site:
position = -57
score = 5.57237
sequence = ACCTTACCATTGTTGGAAGGA

Gene: NGR_b08430: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -58
score = 4.52683
sequence = ACCTTCCGACCGTTGTAAGCC

Gene: NGR_b07400: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -58
score = 5.30739
sequence = ACCTTCCCACCGTTGGAAGCC

Gene: NGR_b12440: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -64
score = 5.71226
sequence = ACCTTCCAGTCGCTGGAAGGT

Gene: pRL110010: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -56
score = 5.47744
sequence = ACCTTCCCATCATAGGAAGGA

Gene: pRL110331: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Rhizobium etli CFN 42

Site:
position = -63
score = 5.74921
sequence = ACCTTCCAGTTGCTGGAAGGT

Gene: RHE_PE00007: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -54
score = 5.38205
sequence = ACCTTGCCACGATGGGAAGCC

Gene: Atu1195: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -110
score = 5.62174
sequence = ACCTTCCCATCATGGGAAGCC

Gene: Atu0937: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Mesorhizobium sp. BNC1

Site:
position = -49
score = 5.4631
sequence = ACCTTCCAGTAACTGGAAGGA

Gene: Meso_2667: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -66
score = 5.39235
sequence = ACCTTCCCATCGTTGGAAGCC

Site:
position = -115
score = 5.30739
sequence = GGCTTCCCACCGTTGGAAGGT

Gene: Meso_3893: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Mesorhizobium loti MAFF303099

Site:
position = -62
score = 5.215
sequence = ACCTTCCAGTTACTGGAAGCA

Gene: mlr5325: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Brucella melitensis 16M

Site:
position = -77
score = 5.35626
sequence = ACCTTCCAACGGTTGGAAGGG

Gene: BMEI1730: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Copper-translocating P-type ATPase (EC 3.6.3.4)
COG2871
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234

Gene: NGR_b07390: Putative oxidoreductase
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1196: Putative oxidoreductase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Putative oxidoreductase
cueR
 2
Sinorhizobium meliloti 1021

Gene: SMb21579: Copper-responsive transcriptional regulator, MerR family

Gene: SMa1014: Copper-responsive transcriptional regulator, MerR family
 3
Rhizobium sp. NGR234

Gene: NGR_b07380: Copper-responsive transcriptional regulator, MerR family

Gene: NGR_b12430: Copper-responsive transcriptional regulator, MerR family

Gene: NGR_b08420: Copper-responsive transcriptional regulator, MerR family
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL110009: Copper-responsive transcriptional regulator, MerR family

Gene: pRL110330: Copper-responsive transcriptional regulator, MerR family
 
Rhizobium etli CFN 42

Gene: RHE_PE00006: Copper-responsive transcriptional regulator, MerR family
 2
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1197: Copper-responsive transcriptional regulator, MerR family

Gene: Atu0938: Copper-responsive transcriptional regulator, MerR family
 
Mesorhizobium sp. BNC1

Gene: Meso_3892: Copper-responsive transcriptional regulator, MerR family
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEI1729: Copper-responsive transcriptional regulator, MerR family
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Copper-responsive transcriptional regulator, MerR family
cueO
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234

Gene: NGR_b07370: Multicopper oxidase
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Multicopper oxidase
copG
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_3891: Predicted metal binding protein
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Predicted metal binding protein
 
CRON 2.
PF11162
*
Sinorhizobium meliloti 1021

Site:
position = -147
score = 5.03409
sequence = ACCTTGCCATCGTTGTAAGCC

Gene: SMc02279: Hypothetical protein
*
Rhizobium sp. NGR234

Site:
position = -135
score = 4.75459
sequence = ACCTTACCATCGTTGGAAACA

Gene: NGR_b08300: Hypothetical protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hypothetical protein
SMc02280
 
Sinorhizobium meliloti 1021

Gene: SMc02280: Hypothetical protein
 
Rhizobium sp. NGR234

Gene: NGR_b08290: Hypothetical protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bsl2212: Hypothetical protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6517: Hypothetical protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Hypothetical protein
copB
 
Sinorhizobium meliloti 1021

Gene: SMc02281: Copper tolerance outer membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_b08280: Copper tolerance outer membrane protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3992: Copper tolerance outer membrane protein
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll2211: Copper tolerance outer membrane protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6518: Copper tolerance outer membrane protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Copper tolerance outer membrane protein
cueO
 
Sinorhizobium meliloti 1021

Gene: SMc02282: Multicopper oxidase
 
Rhizobium sp. NGR234

Gene: NGR_b08270: Multicopper oxidase
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3991: Multicopper oxidase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll2210: Multicopper oxidase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6519: Multicopper oxidase
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Multicopper oxidase
copC
 
Sinorhizobium meliloti 1021

Gene: SMc02283: Cupredoxin
 
Rhizobium sp. NGR234

Gene: NGR_b08260: Cupredoxin
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3990: Cupredoxin
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll2209: Cupredoxin
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6520: Cupredoxin
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Cupredoxin
cusF
 
Sinorhizobium meliloti 1021

Gene: SMc02284: Heavy metal efflux RND periplasmic protein
 
Rhizobium sp. NGR234

Gene: NGR_b08250: Heavy metal efflux RND periplasmic protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110

Gene: bll2208: Heavy metal efflux RND periplasmic protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6521: Heavy metal efflux RND periplasmic protein
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Heavy metal efflux RND periplasmic protein
 
CRON 3.
copZ
*2
Sinorhizobium meliloti 1021

Site:
position = -57
score = 5.70718
sequence = ACCTTGCCATCGTTGGAAGCT

Gene: SMb20560: Copper chaperone

Site:
position = -59
score = 4.6501
sequence = ACCTTGCCATCGTTGGAAACG

Gene: SMa1009: Copper chaperone
*
Rhizobium sp. NGR234

Site:
position = -57
score = 4.9065
sequence = ACCCTGCCATCGTTGGAAGCC

Gene: NGR_b08480: Copper chaperone
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -35
score = 5.30739
sequence = ACCTTCCAACGGTGGGAAGCC

Gene: Meso_3894: Copper chaperone
 
Mesorhizobium loti MAFF303099
*
Brucella melitensis 16M

Site:
position = -59
score = 5.85162
sequence = ACCTTGCCACGATGGGAAGCT

Gene: BMEI1032: Copper chaperone
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Copper chaperone
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD