Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1
Thauera sp. MZ1T 1 1
Dechloromonas aromatica RCB
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans 2 1
Chromobacterium violaceum ATCC 12472
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8 4 3
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cusC
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
*
Methylotenera mobilis JLW8

Site:
position = -290
score = 5.5509
sequence = ACCTTACAATTGTTGGAAGCT

Gene: Mmol_1490: Heavy metal efflux RND outer membrane protein, CzcC family
 
Methylophilales bacterium HTCC2181
Heavy metal efflux RND outer membrane protein, CzcC family
copA
 
Azoarcus sp. EbN1
*
Thauera sp. MZ1T

Site:
position = -62
score = 5.54571
sequence = ACCTTCCCACGTTGGCAAGGT

Gene: Tmz1t_3243: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
*
Thiobacillus denitrificans

Site:
position = -59
score = 6.02995
sequence = ACCTTGCCATGATGGCAAGGT

Gene: Tbd_2266: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8

Gene: Mmol_1491: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Methylophilales bacterium HTCC2181
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans

Gene: Tbd_2267: Copper-responsive transcriptional regulator, MerR family
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
*
Methylotenera mobilis JLW8

Site:
position = -156
score = 5.5509
sequence = AGCTTCCAACAATTGTAAGGT

Site:
position = -107
score = 4.76718
sequence = ACCTTACAATAGTGGAAAGCA

Gene: Mmol_1488: Copper-responsive transcriptional regulator, MerR family
 
Methylophilales bacterium HTCC2181
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
copZ
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
*
Methylotenera mobilis JLW8

Site:
position = -115
score = 4.76718
sequence = TGCTTTCCACTATTGTAAGGT

Site:
position = -66
score = 5.5509
sequence = ACCTTACAATTGTTGGAAGCT

Gene: Mmol_1489: Copper chaperone
 
Methylophilales bacterium HTCC2181
Copper chaperone
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD