Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243 1 1
Burkholderia mallei ATCC 23344
Burkholderia sp. 383 1 1
Burkholderia cepacia AMMD 1 1
Burkholderia vietnamiensis G4 5 4
Burkholderia glumae BGR1
Burkholderia xenovorans LB400 3 3
Burkholderia phymatum STM815 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
*
Burkholderia pseudomallei K96243

Site:
position = -11
score = 5.60479
sequence = ACCTTCCCACAGTGGGAAGAT

Gene: BPSL0301: Copper chaperone
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -64
score = 5.76666
sequence = ACCTTCCCACCGTGGCAAGCT

Gene: Bcep18194_A6338: Copper chaperone
*
Burkholderia cepacia AMMD

Site:
position = -64
score = 5.85162
sequence = ACCTTCCCACCATGGCAAGCT

Gene: Bamb_3036: Copper chaperone
*3
Burkholderia vietnamiensis G4

Site:
position = -64
score = 5.85162
sequence = ACCTTCCCACCATGGCAAGCT

Gene: Bcep1808_3075: Copper chaperone

Gene: Bcep1808_7186: Copper chaperone

Site:
position = -32
score = 5.63209
sequence = ACCTTCCCATCGTTGGAACGT

Gene: Bcep1808_7262: Copper chaperone
 
Burkholderia glumae BGR1
*2
Burkholderia xenovorans LB400

Site:
position = -90
score = 6.18468
sequence = ACCTTGCCATCATGGGAAGGT

Gene: Bxe_A3162: Copper chaperone

Site:
position = -58
score = 5.83931
sequence = ACCTTACCGCCGTGGGAAGGT

Gene: Bxe_B2298: Copper chaperone
*
Burkholderia phymatum STM815

Site:
position = -89
score = 6.20645
sequence = ACCTTCCCACTGTGGGAAGGT

Gene: Bphy_1968: Copper chaperone
Copper chaperone
 
CRON 2.
cueR2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
*3
Burkholderia vietnamiensis G4

Gene: Bcep1808_7261: Copper-responsive transcriptional regulator, MerR family

Site:
position = -26
score = 6.2914
sequence = ACCTTCCCATAGTGGGAAGGT

Gene: Bcep1808_3973: Copper-responsive transcriptional regulator, MerR family

Site:
position = -69
score = 5.70044
sequence = ACCTTCCCAACGTGGGAAGGT

Gene: Bcep1808_7183: Copper-responsive transcriptional regulator, MerR family
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Copper-responsive transcriptional regulator, MerR family
copA2
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 2
Burkholderia vietnamiensis G4

Gene: Bcep1808_3972: Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: Bcep1808_7191: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Copper-translocating P-type ATPase (EC 3.6.3.4)
 
CRON 3.
cueR
 
Burkholderia pseudomallei K96243

Gene: BPSS0351: Copper-responsive transcriptional regulator, MerR family
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_A5545: Copper-responsive transcriptional regulator, MerR family
 
Burkholderia cepacia AMMD

Gene: Bamb_2255: Copper-responsive transcriptional regulator, MerR family
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_2302: Copper-responsive transcriptional regulator, MerR family
 
Burkholderia glumae BGR1

Gene: bglu_1g25600: Copper-responsive transcriptional regulator, MerR family
*
Burkholderia xenovorans LB400

Site:
position = -8
score = 6.18468
sequence = ACCTTCCCATGATGGCAAGGT

Gene: Bxe_A3161: Copper-responsive transcriptional regulator, MerR family
*
Burkholderia phymatum STM815

Site:
position = -64
score = 6.20645
sequence = ACCTTCCCACAGTGGGAAGGT

Gene: Bphy_1967: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD