Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1
Acinetobacter baumannii AB0057 3 2
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -123
score = 5.55858
sequence = AGATTCCCATCATGGGAAGGT

Site:
position = -72
score = 5.41626
sequence = ACCTTACAATCATGACAAGGT

Gene: AB57_1352: Copper chaperone
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Copper chaperone
 
CRON 2.
copA
 
Acinetobacter sp. ADP1
*
Acinetobacter baumannii AB0057

Site:
position = -121
score = 5.41626
sequence = ACCTTGTCATGATTGTAAGGT

Site:
position = -70
score = 5.55858
sequence = ACCTTCCCATGATGGGAATCT

Gene: AB57_1353: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057

Gene: AB57_1354: Copper resistance ranscriptional regulator, MerR family
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Copper resistance ranscriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD