Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 4 2
Pseudomonas entomophila L48 3 2
Pseudomonas putida KT2440 4 3
Pseudomonas syringae pv. tomato str. DC3000 3 2
Pseudomonas fluorescens Pf-5 3 2
Pseudomonas mendocina ymp 3 3
Pseudomonas stutzeri A1501 7 4
Azotobacter vinelandii AvOP 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copA
*
Pseudomonas aeruginosa PAO1

Site:
position = -97
score = 4.90109
sequence = ACCTTGACACGATGTCAAGGC

Gene: PA3920: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Pseudomonas entomophila L48

Site:
position = -55
score = 5.29797
sequence = ACCTTGACCGCATGGCAAGGT

Gene: PSEEN0669: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Pseudomonas putida KT2440

Site:
position = -53
score = 5.30031
sequence = ACCTTGCCTGCGTGGCAAGGT

Gene: PP0586: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -59
score = 5.35593
sequence = ACCTTGCCCATGTGGCAAGGT

Gene: PSPTO0750: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Pseudomonas fluorescens Pf-5

Site:
position = -56
score = 5.30031
sequence = ACCTTGCCTGCGTGGCAAGGT

Gene: PFL_0710: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Pseudomonas mendocina ymp

Site:
position = -57
score = 5.58581
sequence = ACCTTGCCATGGGGTCAAGGT

Gene: Pmen_0821: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Pseudomonas stutzeri A1501

Site:
position = -58
score = 5.57397
sequence = ACCTTGCCATAGGGTTAAGGT

Gene: PST_3613: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Azotobacter vinelandii AvOP
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Pseudomonas aeruginosa PAO1

Gene: PA4778: Copper-responsive transcriptional regulator, MerR family
 
Pseudomonas entomophila L48

Gene: PSEEN0668: Copper-responsive transcriptional regulator, MerR family
 
Pseudomonas putida KT2440

Gene: PP0585: Copper-responsive transcriptional regulator, MerR family
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0749: Copper-responsive transcriptional regulator, MerR family
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0709: Copper-responsive transcriptional regulator, MerR family
 
Pseudomonas mendocina ymp

Gene: Pmen_0812: Copper-responsive transcriptional regulator, MerR family
 
Pseudomonas stutzeri A1501

Gene: PST_3614: Copper-responsive transcriptional regulator, MerR family
 
Azotobacter vinelandii AvOP

Gene: Avin_10060: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
copZ2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
*
Pseudomonas putida KT2440

Site:
position = -71
score = 5.23737
sequence = ACCTTGTCATCGTGTCAAGGT

Gene: PP5393: Copper chaperone
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Copper chaperone
 
CRON 3.
PA3523
*
Pseudomonas aeruginosa PAO1

Site:
position = -89
score = 5.10381
sequence = ACCTTGCCAAGGTGTCAAGGT

Gene: PA3523: RND efflux system, membrane fusion protein
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
RND efflux system, membrane fusion protein
PA3522
 
Pseudomonas aeruginosa PAO1

Gene: PA3522: RND efflux system, inner membrane transporter
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
RND efflux system, inner membrane transporter
PA3521
 
Pseudomonas aeruginosa PAO1

Gene: PA3521: RND efflux system, outer membrane protein
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
RND efflux system, outer membrane protein
 
CRON 4.
copZ2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*2
Pseudomonas stutzeri A1501

Site:
position = -65
score = 5.48248
sequence = ACCTTGCCGCTCTGGCAAGGT

Gene: PST_3386: Copper chaperone

Site:
position = -67
score = 5.53116
sequence = ACCTTGCCATGGCGTCAAGGT

Gene: PST_2713: Copper chaperone
 
Azotobacter vinelandii AvOP
Copper chaperone
copG
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440

Gene: PP5377: Predicted metal-binding protein
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2891: Predicted metal-binding protein
 
Pseudomonas mendocina ymp

Gene: Pmen_2215: Predicted metal-binding protein
 2
Pseudomonas stutzeri A1501

Gene: PST_3385: Predicted metal-binding protein

Gene: PST_2714: Predicted metal-binding protein
 
Azotobacter vinelandii AvOP
Predicted metal-binding protein
 
CRON 5.
copZ
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -56
score = 5.87299
sequence = ACCTTGCCCCGATGGCAAGGT

Gene: PSEEN0671: Copper chaperone
*
Pseudomonas putida KT2440

Site:
position = -56
score = 5.28939
sequence = ACCTTGTCCTGATGGCAAGCT

Gene: PP0588: Copper chaperone
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -59
score = 6.02995
sequence = ACCTTGCCATGATGGCAAGGT

Gene: PSPTO0752: Copper chaperone
*
Pseudomonas fluorescens Pf-5

Site:
position = -56
score = 5.48897
sequence = ACCTTGCCACGGTGGCAAGGA

Gene: PFL_0712: Copper chaperone
*2
Pseudomonas mendocina ymp

Site:
position = -72
score = 5.65782
sequence = ACCTTGCCATCGTGTCAAGGT

Gene: Pmen_2225: Copper chaperone

Site:
position = -8
score = 5.69689
sequence = ACCTTGCCATGGTGGCAAGCT

Gene: Pmen_0823: Copper chaperone
*
Pseudomonas stutzeri A1501

Site:
position = -58
score = 5.32409
sequence = ACCTTGCCAGGGTGGCAAGCT

Gene: PST_3612: Copper chaperone
*
Azotobacter vinelandii AvOP

Site:
position = -59
score = 5.18008
sequence = ACCTTGCCCGGGGGGCAAGCT

Gene: Avin_10070: Copper chaperone
Copper chaperone
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD