Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40 3 3
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107 6 4
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -75
score = 4.60486
sequence = ACCTTACCACAATGGGAGACA

Gene: Sde_1951: Copper chaperone
 
Teredinibacter turnerae T7901
*2
Cellvibrio japonicus Ueda107

Site:
position = -63
score = 5.32291
sequence = ACCTTACCATGATGTCAAGGA

Gene: CJA_2023: Copper chaperone

Site:
position = -60
score = 4.87048
sequence = ACCTTGCCACCGAGGCAAGCC

Gene: CJA_1835: Copper chaperone
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Copper chaperone
 
CRON 2.
copA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -54
score = 5.19593
sequence = ACTTTCCCACGATGGCAAGGA

Gene: Sde_1952: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Teredinibacter turnerae T7901
*2
Cellvibrio japonicus Ueda107

Site:
position = -247
score = 5.32291
sequence = ACCTTACCATGATGTCAAGGA

Gene: CJA_2024: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -58
score = 6.13588
sequence = ACCTTACCATGATGGGAAGGT

Gene: CJA_1836: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -59
score = 5.55434
sequence = ACCTTCCTATAATGGGAGGGT

Gene: Sde_1950: Copper-responsive transcriptional regulator, MerR family
 
Teredinibacter turnerae T7901
 2
Cellvibrio japonicus Ueda107

Gene: CJA_2025: Copper-responsive transcriptional regulator, MerR family

Gene: CJA_1837: Copper-responsive transcriptional regulator, MerR family
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Copper-responsive transcriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD