Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 4 2
Psychromonas sp. CNPT3 6 2
Moritella sp. PE36 9 3
Aeromonas hydrophila subsp. hydrophila ATCC 7966 2 1
Aeromonas salmonicida subsp. salmonicida A449 2 1
Tolumonas auensis DSM 9187 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
*
Tolumonas auensis DSM 9187

Site:
position = -56
score = 5.87508
sequence = ACCTTCCAATAGAGGGAAGGT

Gene: Tola_0588: Copper chaperone
Copper chaperone
 
CRON 2.
copA
*
Psychromonas ingrahamii 37

Site:
position = -62
score = 4.76821
sequence = ACCTTACCCTAAGGGTAATGG

Gene: Ping_1340: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Psychromonas sp. CNPT3

Site:
position = -59
score = 4.45975
sequence = ACCTTAACCTATGGGTAAGGG

Gene: PCNPT3_05574: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Moritella sp. PE36

Site:
position = -62
score = 4.62377
sequence = ACCTTACACTAAGGGTAAAGG

Gene: PE36_15557: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -70
score = 3.75082
sequence = CCCTTACAGTAAAGGTTAGGG

Gene: AHA_4222: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -75
score = 3.97456
sequence = AGCTTACCCTTACAGTAAAGG

Site:
position = -69
score = 3.75082
sequence = CCCTTACAGTAAAGGTTAGGG

Gene: ASA_0103: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Tolumonas auensis DSM 9187

Site:
position = -60
score = 5.27321
sequence = ACCTTGCCATGATGTCAAGGC

Gene: Tola_0589: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Psychromonas ingrahamii 37

Gene: Ping_1339: Copper-responsive transcriptional regulator, MerR family
 
Psychromonas sp. CNPT3

Gene: PCNPT3_05569: Copper-responsive transcriptional regulator, MerR family
 
Moritella sp. PE36

Gene: PE36_15562: Copper-responsive transcriptional regulator, MerR family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4221: Copper-responsive transcriptional regulator, MerR family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0104: Copper-responsive transcriptional regulator, MerR family
 
Tolumonas auensis DSM 9187

Gene: Tola_0590: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 3.
PCNPT3_11152
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -56
score = 4.56347
sequence = ACCTTACCGTTAGGGGAGCTT

Gene: PCNPT3_11152: hypothetical protein
*
Moritella sp. PE36

Site:
position = -68
score = 4.92515
sequence = ACCTTCCCCTTAAGGTAAAGA

Gene: PE36_15789: hypothetical protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
hypothetical protein
cuzC
 
Psychromonas ingrahamii 37

Gene: Ping_1368: Heavy metal RND efflux outer membrane protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11147: Heavy metal RND efflux outer membrane protein
 
Moritella sp. PE36

Gene: PE36_15784: Heavy metal RND efflux outer membrane protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Heavy metal RND efflux outer membrane protein
cusB
 
Psychromonas ingrahamii 37

Gene: Ping_1369: Heavy metal RND efflux periplasmic protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11142: Heavy metal RND efflux periplasmic protein
 
Moritella sp. PE36

Gene: PE36_15779: Heavy metal RND efflux periplasmic protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Heavy metal RND efflux periplasmic protein
cusA
 
Psychromonas ingrahamii 37

Gene: Ping_1370: Heavy metal RND efflux inner membrane protein
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11137: Heavy metal RND efflux inner membrane protein
 
Moritella sp. PE36

Gene: PE36_15774: Heavy metal RND efflux inner membrane protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Heavy metal RND efflux inner membrane protein
Ping_1371
 
Psychromonas ingrahamii 37

Gene: Ping_1371: putative copper resistance protein
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_15769: putative copper resistance protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
putative copper resistance protein
 
CRON 4.
copA2
*
Psychromonas ingrahamii 37

Site:
position = -69
score = 4.63413
sequence = ACCTTCCCCTAAGAGTAATGA

Gene: Ping_1381: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -182
score = 4.29451
sequence = GGTTTACCTTAGCTGGAAGGT

Site:
position = -97
score = 4.77265
sequence = ACCTTCCAGTTAGGGTAAAGG

Gene: PE36_19605: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Copper-translocating P-type ATPase (EC 3.6.3.4)
COG4633
 
Psychromonas ingrahamii 37

Gene: Ping_1382: Putative cupredoxin
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_19610: Putative cupredoxin
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Putative cupredoxin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD