Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20 4 2
Aggregatibacter aphrophilus NJ8700 4 2
Pasteurella multocida subsp. multocida str. Pm70 2 1
Mannheimia succiniciproducens MBEL55E 3 2
Actinobacillus succinogenes 130Z 2 2
Haemophilus somnus 2336 3 2
Actinobacillus pleuropneumoniae serovar 7 str. AP76 4 2
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cueR
*
Haemophilus influenzae Rd KW20

Site:
position = -34
score = 4.9694
sequence = ACCTTTACATAAGGTTAAGGT

Gene: HI0293: Copper-responsive transcriptional regulator, MerR family
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -33
score = 5.19629
sequence = ACCTTAACGTTAGGTTAAGGT

Gene: NT05HA_0167: Copper-responsive transcriptional regulator, MerR family
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -55
score = 5.79044
sequence = ACCTTGACCTAAGGGGAAGGT

Gene: MS0886: Copper-responsive transcriptional regulator, MerR family
*
Actinobacillus succinogenes 130Z

Site:
position = -63
score = 4.99954
sequence = ACCTTGACGTAAGGGTAAAGT

Gene: Asuc_1033: Copper-responsive transcriptional regulator, MerR family
*
Haemophilus somnus 2336

Site:
position = -72
score = 4.40278
sequence = ACCTTGCGTTAGGGTCAAGGA

Gene: HSM_1728: Copper-responsive transcriptional regulator, MerR family
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -35
score = 4.79492
sequence = TCCTTAACCCTAGGTTAAGGT

Gene: APP7_1312: Copper-responsive transcriptional regulator, MerR family
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -78
score = 4.4126
sequence = AGCCTAACCTTATGTTAGGGT

Gene: HAPS_1832: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
COG3019
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -64
score = 4.96668
sequence = ACCTTAACCCTAGGTCAAGCT

Gene: PM1939: putative metal-binding protein
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
*
Haemophilus somnus 2336

Site:
position = -66
score = 4.91788
sequence = ACCTTAACCCTAGGTTAAGCT

Gene: HSM_1725: putative metal-binding protein
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -71
score = 4.79492
sequence = ACCTTAACCTAGGGTTAAGGA

Gene: APP7_1313: putative metal-binding protein
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
putative metal-binding protein
copA0
*2
Haemophilus influenzae Rd KW20

Site:
position = -63
score = 4.9694
sequence = ACCTTAACCTTATGTAAAGGT

Gene: HI0292: truncated copper-transporting P-type ATPase

Gene: HI0291: truncated copper-transporting P-type ATPase
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -82
score = 5.19629
sequence = ACCTTAACCTAACGTTAAGGT

Gene: NT05HA_0168: truncated copper-transporting P-type ATPase
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1891: truncated copper-transporting P-type ATPase
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -68
score = 5.79044
sequence = ACCTTCCCCTTAGGTCAAGGT

Gene: MS0887: truncated copper-transporting P-type ATPase
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1314: truncated copper-transporting P-type ATPase
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
truncated copper-transporting P-type ATPase
copA
 
Haemophilus influenzae Rd KW20

Gene: HI0290: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0170: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1892: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0888: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Actinobacillus succinogenes 130Z

Site:
position = -28
score = 4.99954
sequence = ACTTTACCCTTACGTCAAGGT

Gene: Asuc_1034: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1315: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165

Gene: HAPS_2154: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
NT05HA_0169
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0169: hypothetical protein
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
hypothetical protein
cueO
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM1938: Multicopper oxidase
 
Mannheimia succiniciproducens MBEL55E
 
Actinobacillus succinogenes 130Z
 
Haemophilus somnus 2336

Gene: HSM_1726: Multicopper oxidase
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Multicopper oxidase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD