Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 3 2
Vibrio vulnificus CMCP6 8 3
Vibrio harveyi ATCC BAA-1116 8 3
Vibrio parahaemolyticus RIMD 2210633 9 3
Vibrio shilonii AK1 7 2
Vibrio splendidus LGP32 5 1
Vibrio fischeri ES114 8 3
Vibrio salmonicida LFI1238 8 3
Vibrio angustum S14 2 2
Photobacterium profundum SS9 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cueR
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0974: Copper-responsive transcriptional regulator, MerR family
 
Vibrio vulnificus CMCP6

Gene: VV20113: Copper-responsive transcriptional regulator, MerR family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06131: Copper-responsive transcriptional regulator, MerR family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0662: Copper-responsive transcriptional regulator, MerR family
 
Vibrio shilonii AK1

Gene: VSAK1_08833: Copper-responsive transcriptional regulator, MerR family
 
Vibrio splendidus LGP32

Gene: VS_2283: Copper-responsive transcriptional regulator, MerR family
*
Vibrio fischeri ES114

Site:
position = -46
score = 5.48541
sequence = ACCTTACAGTTAATGGAAGGT

Gene: VF_0782: Copper-responsive transcriptional regulator, MerR family
*
Vibrio salmonicida LFI1238

Site:
position = -47
score = 5.48541
sequence = ACCTTACAGTAAATGGAAGGT

Gene: VSAL_I0803: Copper-responsive transcriptional regulator, MerR family
*
Vibrio angustum S14

Site:
position = -73
score = 5.21019
sequence = ACCTTCTAGTTACTGTAAGGT

Gene: VAS14_16481: Copper-responsive transcriptional regulator, MerR family
*
Photobacterium profundum SS9

Site:
position = -82
score = 4.74729
sequence = ACCTTCTGGTTGGTGTAAGGT

Gene: PBPRA2823: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 2.
PF00034
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -58
score = 5.73614
sequence = AGCTTCCCCTTAGGGGAAGCT

Gene: VV20052: Cytochrome c553
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -64
score = 5.73614
sequence = AGCTTCCCCTAAGGGGAAGCT

Gene: VIBHAR_05667: Cytochrome c553
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = 3
score = 5.73614
sequence = AGCTTCCCCTTAGGGGAAGCT

Gene: VPA1012: Cytochrome c553
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Cytochrome c553
 
CRON 3.
VCA0262
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -57
score = 4.52231
sequence = ACCTTCCCCTAGGGTAAAACT

Gene: VCA0262: Conserved hypothetical protein
*
Vibrio vulnificus CMCP6

Site:
position = -102
score = 4.8515
sequence = ACCTTACCCTAGGGTAAAGCT

Gene: VV20849: Conserved hypothetical protein
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -58
score = 5.01562
sequence = ACCTTCCCCTAAGGTTAACCT

Gene: VIBHAR_06363: Conserved hypothetical protein
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -72
score = 4.68512
sequence = ACTTTCCCCCTAGGGTAACCT

Gene: VPA0484: Conserved hypothetical protein
*3
Vibrio shilonii AK1

Gene: VSAK1_07509: Conserved hypothetical protein

Gene: VSAK1_07549: Conserved hypothetical protein

Site:
position = -56
score = 5.90122
sequence = ACCTTCCCCTTAGGGGAGGGT

Gene: VSAK1_10308: Conserved hypothetical protein
*
Vibrio splendidus LGP32

Site:
position = -53
score = 5.55089
sequence = ACCTTACCCTAAGGGGAACGT

Gene: VS_II0513: Conserved hypothetical protein
*
Vibrio fischeri ES114

Site:
position = -50
score = 5.50869
sequence = ACCTTCCCCTAAGTGGAGGCT

Gene: VF_A0442: Conserved hypothetical protein
*
Vibrio salmonicida LFI1238

Site:
position = -59
score = 5.41482
sequence = ACCTTACCCTAAGTGGAAGGC

Gene: VSAL_II0717: Conserved hypothetical protein
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -201
score = 5.47173
sequence = ACCTTACCCTTAGGGAAAGGT

Gene: PBPRA1006: Conserved hypothetical protein
Conserved hypothetical protein
VPA0483
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0483: unknown
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
unknown
cusC
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20850: Heavy metal RND efflux outer membrane protein, CzcC family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06364: Heavy metal RND efflux outer membrane protein, CzcC family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0482: Heavy metal RND efflux outer membrane protein, CzcC family
 2
Vibrio shilonii AK1

Gene: VSAK1_07514: Heavy metal RND efflux outer membrane protein, CzcC family

Gene: VSAK1_10303: Heavy metal RND efflux outer membrane protein, CzcC family
 
Vibrio splendidus LGP32

Gene: VS_II0514: Heavy metal RND efflux outer membrane protein, CzcC family
 
Vibrio fischeri ES114

Gene: VF_A0443: Heavy metal RND efflux outer membrane protein, CzcC family
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0716: Heavy metal RND efflux outer membrane protein, CzcC family
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1005: Heavy metal RND efflux outer membrane protein, CzcC family
Heavy metal RND efflux outer membrane protein, CzcC family
cusB
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20851: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06365: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0481: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 2
Vibrio shilonii AK1

Gene: VSAK1_07519: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family

Gene: VSAK1_10298: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 
Vibrio splendidus LGP32

Gene: VS_II0515: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 
Vibrio fischeri ES114

Gene: VF_A0444: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0715: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1004: Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
Cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family
cusA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20852: Cation efflux system protein CusA, transmembrane protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06366: Cation efflux system protein CusA, transmembrane protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0480: Cation efflux system protein CusA, transmembrane protein
 2
Vibrio shilonii AK1

Gene: VSAK1_07524: Cation efflux system protein CusA, transmembrane protein

Gene: VSAK1_10293: Cation efflux system protein CusA, transmembrane protein
 
Vibrio splendidus LGP32

Gene: VS_II0516: Cation efflux system protein CusA, transmembrane protein
 
Vibrio fischeri ES114

Gene: VF_A0445: Cation efflux system protein CusA, transmembrane protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0714: Cation efflux system protein CusA, transmembrane protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1003: Cation efflux system protein CusA, transmembrane protein
Cation efflux system protein CusA, transmembrane protein
cusF
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV20853: putative blue copper protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06367: putative blue copper protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0479: putative blue copper protein
 2
Vibrio shilonii AK1

Gene: VSAK1_07529: putative blue copper protein

Gene: VSAK1_10288: putative blue copper protein
 
Vibrio splendidus LGP32

Gene: VS_II0517: putative blue copper protein
 
Vibrio fischeri ES114

Gene: VF_A0446: putative blue copper protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0713: putative blue copper protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA1002: putative blue copper protein
putative blue copper protein
 
CRON 4.
copA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -29
score = 5.33823
sequence = ACCTTACCTTAAGGTTAAGGT

Gene: VC2215: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio vulnificus CMCP6

Site:
position = -60
score = 5.8161
sequence = ACCTTCCCCCGGCGGCAAGGT

Gene: VV1_0239: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -57
score = 5.60184
sequence = ACCTTCCCCTTGCAGGAAGGT

Gene: VIBHAR_01268: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -58
score = 5.59954
sequence = ACCTTCCCCTTGATGTAAGGT

Gene: VP0758: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio shilonii AK1

Site:
position = -100
score = 5.68568
sequence = ACCTTACCCTTGCGGTAAGGT

Gene: VSAK1_08868: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Vibrio splendidus LGP32

Gene: VS_0768: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio fischeri ES114

Site:
position = -60
score = 5.48541
sequence = ACCTTCCATTAACTGTAAGGT

Gene: VF_0781: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio salmonicida LFI1238

Site:
position = -61
score = 5.48541
sequence = ACCTTCCATTTACTGTAAGGT

Gene: VSAL_I0802: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Vibrio angustum S14

Site:
position = -107
score = 5.21019
sequence = ACCTTACAGTAACTAGAAGGT

Gene: VAS14_16476: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Photobacterium profundum SS9

Site:
position = -92
score = 4.74729
sequence = ACCTTACACCAACCAGAAGGT

Gene: PBPRA2824: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
copG
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2216: Predicted metal-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV1_0240: Predicted metal-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01267: Predicted metal-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0757: Predicted metal-binding protein
 
Vibrio shilonii AK1

Gene: VSAK1_08863: Predicted metal-binding protein
 
Vibrio splendidus LGP32

Gene: VS_0767: Predicted metal-binding protein
 
Vibrio fischeri ES114

Gene: VF_0780: Predicted metal-binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0801: Predicted metal-binding protein
 
Vibrio angustum S14

Gene: VAS14_02436: Predicted metal-binding protein
 
Photobacterium profundum SS9

Gene: PBPRA1905: Predicted metal-binding protein
Predicted metal-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD