Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 3 2
Ralstonia pickettii 12J 13 5
Ralstonia metallidurans CH34 11 4
Ralstonia eutropha JMP134 3 2
Ralstonia eutropha H16 4 3
Cupriavidus taiwanensis 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
*
Ralstonia solanacearum GMI1000

Site:
position = -69
score = 4.94927
sequence = CGTTTCCCATGGTGGGAAGGT

Gene: RS02624: Copper chaperone
*
Ralstonia pickettii 12J

Site:
position = -66
score = 5.12843
sequence = CACTTCCCACGATGGGAAGGT

Gene: Rpic_3544: Copper chaperone
 
Ralstonia metallidurans CH34

Gene: Rmet_3525: Copper chaperone
*
Ralstonia eutropha JMP134

Site:
position = -82
score = 5.48199
sequence = CGCTTCCCACCATGGGAAGGT

Gene: Reut_A3377: Copper chaperone
*
Ralstonia eutropha H16

Site:
position = -81
score = 5.48199
sequence = CGCTTCCCACCATGGGAAGGT

Gene: H16_A3669: Copper chaperone
*
Cupriavidus taiwanensis

Site:
position = -80
score = 5.32726
sequence = CGCTTCCCATGGTGGCAAGGT

Gene: RALTA_A3125: Copper chaperone
Copper chaperone
 
CRON 2.
copA
*
Ralstonia solanacearum GMI1000

Site:
position = -61
score = 5.33146
sequence = ACCTTCCTAATATGGGAAGGT

Gene: RS02623: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Ralstonia pickettii 12J

Site:
position = -100
score = 5.12843
sequence = ACCTTCCCATCGTGGGAAGTG

Gene: Rpic_3543: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Ralstonia metallidurans CH34

Site:
position = -67
score = 5.90649
sequence = ACCTTCCAATGGTGGTAAGGT

Gene: Rmet_3524: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Ralstonia eutropha JMP134

Site:
position = -59
score = 5.64498
sequence = ACCTTCCTATGATGGTAAGGT

Gene: Reut_A3376: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Ralstonia eutropha H16

Site:
position = -61
score = 5.99144
sequence = ACCTTCCAATGATGGTAAGGT

Gene: H16_A3668: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Cupriavidus taiwanensis

Site:
position = -60
score = 5.99144
sequence = ACCTTCCAATGATGGTAAGGT

Gene: RALTA_A3123: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Ralstonia solanacearum GMI1000

Gene: RS02622: Copper-responsive transcriptional regulator, MerR family
 
Ralstonia pickettii 12J

Gene: Rpic_3542: Copper-responsive transcriptional regulator, MerR family
 
Ralstonia metallidurans CH34

Gene: Rmet_3523: Copper-responsive transcriptional regulator, MerR family
 
Ralstonia eutropha JMP134

Gene: Reut_A3375: Copper-responsive transcriptional regulator, MerR family
 
Ralstonia eutropha H16

Gene: H16_A3667: Copper-responsive transcriptional regulator, MerR family
 
Cupriavidus taiwanensis

Gene: RALTA_A3122: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
 
CRON 3.
copA2
 
Ralstonia solanacearum GMI1000
*2
Ralstonia pickettii 12J

Gene: Rpic_1804: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -156
score = 5.34053
sequence = ACCTTCCCTCCGTGGAAAGGT

Gene: Rpic_4609: Copper-translocating P-type ATPase (EC 3.6.3.4)
*2
Ralstonia metallidurans CH34

Site:
position = -349
score = 5.75672
sequence = ACCTTCCCATGGCGGGAAGGA

Gene: pMOL30_143: Copper-translocating P-type ATPase (EC 3.6.3.4)

Site:
position = -349
score = 5.75672
sequence = ACCTTCCCATGGCGGGAAGGA

Gene: Rmet_6119: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Ralstonia eutropha JMP134
*
Ralstonia eutropha H16

Site:
position = -358
score = 5.38399
sequence = ACCTTCCAACGATGGGAACCT

Gene: H16_A2173: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Cupriavidus taiwanensis
Copper-translocating P-type ATPase (EC 3.6.3.4)
copG
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 2
Ralstonia metallidurans CH34

Gene: pMOL30_144: CopG protein

Gene: Rmet_6118: CopG protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
CopG protein
cueR2
 
Ralstonia solanacearum GMI1000
*
Ralstonia pickettii 12J

Site:
position = -125
score = 4.89448
sequence = ACCTTCCCACGTGGGCAGGCT

Gene: Rpic_1805: Copper-responsive transcriptional regulator, MerR family
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Copper-responsive transcriptional regulator, MerR family
 
CRON 4.
Rpic_1651
 
Ralstonia solanacearum GMI1000
*
Ralstonia pickettii 12J

Site:
position = -116
score = 5.65875
sequence = ACGTTGCCATTGTGGGAAGGT

Gene: Rpic_1651: hypothetical protein
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
hypothetical protein
Rpic_1650
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J

Gene: Rpic_1650: hypothetical protein
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
hypothetical protein
cusD
 
Ralstonia solanacearum GMI1000

Gene: RS05408: Heavy metal efflux RND transmembrane protein
 
Ralstonia pickettii 12J

Gene: Rpic_1649: Heavy metal efflux RND transmembrane protein
*2
Ralstonia metallidurans CH34

Site:
position = -110
score = 4.5961
sequence = ACGTTCCTGCCGTGGGAACGT

Gene: Rmet_5030: Heavy metal efflux RND transmembrane protein

Gene: Rmet_6133: Heavy metal efflux RND transmembrane protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_A2184: Heavy metal efflux RND transmembrane protein
 
Cupriavidus taiwanensis
Heavy metal efflux RND transmembrane protein
cusC
 
Ralstonia solanacearum GMI1000

Gene: RS05407: Heavy metal efflux RND outer membrane protein, CzcC family
 
Ralstonia pickettii 12J

Gene: Rpic_1648: Heavy metal efflux RND outer membrane protein, CzcC family
 3
Ralstonia metallidurans CH34

Gene: Rmet_5031: Heavy metal efflux RND outer membrane protein, CzcC family

Gene: pMOL30_135: Heavy metal efflux RND outer membrane protein, CzcC family

Gene: Rmet_6134: Heavy metal efflux RND outer membrane protein, CzcC family
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_A2185: Heavy metal efflux RND outer membrane protein, CzcC family
 
Cupriavidus taiwanensis
Heavy metal efflux RND outer membrane protein, CzcC family
cusB
 
Ralstonia solanacearum GMI1000

Gene: RS05406: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family
 
Ralstonia pickettii 12J

Gene: Rpic_1647: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family
 3
Ralstonia metallidurans CH34

Gene: pMOL30_134: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family

Gene: Rmet_6135: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family

Gene: Rmet_5032: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_A2186: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family
 
Cupriavidus taiwanensis
Heavy metal efflux RND transporter, membrane fusion protein, CzcB family
cusA
 
Ralstonia solanacearum GMI1000

Gene: RS05405: Heavy metal efflux RND transmembrane protein, CzcA family
 
Ralstonia pickettii 12J

Gene: Rpic_1646: Heavy metal efflux RND transmembrane protein, CzcA family
 3
Ralstonia metallidurans CH34

Gene: pMOL30_133: Heavy metal efflux RND transmembrane protein, CzcA family

Gene: Rmet_6136: Heavy metal efflux RND transmembrane protein, CzcA family

Gene: Rmet_5033: Heavy metal efflux RND transmembrane protein, CzcA family
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_A2187: Heavy metal efflux RND transmembrane protein, CzcA family
 
Cupriavidus taiwanensis
Heavy metal efflux RND transmembrane protein, CzcA family
cusF
 
Ralstonia solanacearum GMI1000

Gene: RS05404: Heavy metal efflux RND periplasmic protein
 
Ralstonia pickettii 12J

Gene: Rpic_1645: Heavy metal efflux RND periplasmic protein
 
Ralstonia metallidurans CH34

Gene: Rmet_5034: Heavy metal efflux RND periplasmic protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16

Gene: H16_A2188: Heavy metal efflux RND periplasmic protein
 
Cupriavidus taiwanensis
Heavy metal efflux RND periplasmic protein
Rmet_6706
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
 
Ralstonia metallidurans CH34

Gene: Rmet_6706: hypothetical protein
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD