Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ZntR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444
Sphingopyxis alaskensis RB2256 1 1
Sphingobium japonicum UT26S 1 1
Sphingomonas wittichii RW1
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zntR
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
*
Sphingopyxis alaskensis RB2256

Site:
position = -41
score = 4.71312
sequence = ACCTTGGACCATGGTCCAACCT

Gene: Sala_2470: Zinc resistance ranscriptional regulator, MerR family
*
Sphingobium japonicum UT26S

Site:
position = -41
score = 4.08053
sequence = ACCCTGGACCATGGTCCAACCG

Gene: SJA_C1-05190: Zinc resistance ranscriptional regulator, MerR family
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Zinc resistance ranscriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD