Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ZntR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92 1 1
Marinomonas sp. MWYL1 1 1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043 1 1
Reinekea sp. MED297 1 1
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zntA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -60
score = 6.08681
sequence = ACCCTGAAGTTTACTTCAGGGT

Gene: MED92_02778: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*2
Marinomonas sp. MWYL1

Site:
position = -60
score = 5.39889
sequence = ACCTTGGACTATTATCCAAGGT

Gene: Mmwyl1_1611: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)

Gene: Mmwyl1_2255: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_3006: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Reinekea sp. MED297

Site:
position = -18
score = 4.75139
sequence = ACTCTATAGTAAGCTCGAATGT

Gene: MED297_07836: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
 
Alcanivorax borkumensis SK2
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
 
CRON 2.
COG1230
 
Hahella chejuensis KCTC 2396

Gene: HCH_03680: Co/Zn/Cd efflux system component
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -67
score = 5.03626
sequence = GACCTGGAGTGCACTCCAGGGT

Gene: Csal_1006: Co/Zn/Cd efflux system component
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Co/Zn/Cd efflux system component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD