Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ZntR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3 2 1
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966 1 1
Aeromonas salmonicida subsp. salmonicida A449 1 1
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zntA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 2
Moritella sp. PE36

Gene: PE36_24208: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)

Gene: PE36_22520: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -3
score = 6.26539
sequence = ACCTTGGACTTAACACCAAGGT

Gene: AHA_0629: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -84
score = 6.26539
sequence = ACCTTGGACTTAACACCAAGGT

Gene: ASA_0629: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
 
Tolumonas auensis DSM 9187
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
 
CRON 2.
zntR
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -73
score = 6.08405
sequence = ACCTTAGATTCAACTCTAAGGT

Gene: PCNPT3_08420: Zinc resistance transcriptional regulator, MerR family
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0842: Zinc resistance transcriptional regulator, MerR family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3450: Zinc resistance transcriptional regulator, MerR family
 
Tolumonas auensis DSM 9187
Zinc resistance transcriptional regulator, MerR family
PF03773
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_08425: Putative permease of unknown function DUF318
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Putative permease of unknown function DUF318
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD