Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ZntR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 1 1
Vibrio vulnificus CMCP6 1 1
Vibrio harveyi ATCC BAA-1116 1 1
Vibrio parahaemolyticus RIMD 2210633 1 1
Vibrio shilonii AK1 1 1
Vibrio splendidus LGP32 1 1
Vibrio fischeri ES114 1 1
Vibrio salmonicida LFI1238 1 1
Vibrio angustum S14 1 1
Photobacterium profundum SS9 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zntA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -59
score = 6.75655
sequence = ACCTTGAAGTTGACTCCAAGGT

Gene: VC1033: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio vulnificus CMCP6

Site:
position = -59
score = 6.60071
sequence = ACCTTGGAGCTGACTCTAAGGT

Gene: VV1_2063: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -308
score = 6.65189
sequence = ACCTTGGAGTTAGCTCTAAGGT

Gene: VIBHAR_01515: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -71
score = 6.63807
sequence = ACCTTGGAGCTAGCTCCAAGGT

Gene: VP0959: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio shilonii AK1

Site:
position = -59
score = 6.63807
sequence = ACCTTGGAGCTAGCTCCAAGGT

Gene: VSAK1_03780: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio splendidus LGP32

Site:
position = -104
score = 6.41858
sequence = ACCTTGGAGTAGTCTCCAAGGT

Gene: VS_2083: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio fischeri ES114

Site:
position = -77
score = 6.91674
sequence = ACCTTGGAGTTAACTCTAAGGT

Gene: VF_1522: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio salmonicida LFI1238

Site:
position = -74
score = 6.6657
sequence = ACCTTAGAGTTAACTCTAAGGT

Gene: VSAL_I2067: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Vibrio angustum S14

Site:
position = -65
score = 5.85864
sequence = ACCTTAGACATTACTCCAAGGT

Gene: VAS14_05123: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
*
Photobacterium profundum SS9

Site:
position = -89
score = 6.63731
sequence = ACCTTGGATTTAACTCCAAGGT

Gene: PBPRA1220: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD