Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 1 1
Erythrobacter sp. NAP1 1 1
Novosphingobium aromaticivorans DSM 12444 2 1
Sphingopyxis alaskensis RB2256 3 2
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF00903
*
Erythrobacter litoralis HTCC2594

Site:
position = -113
score = 6.24898
sequence = ACCTCAAGTCAGCTTGAGGT

Gene: ELI_02955: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Erythrobacter sp. NAP1

Site:
position = -26
score = 6.20633
sequence = ATCTCAAGTTAGGTTGAGGT

Gene: NAP1_02240: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -72
score = 6.20862
sequence = ATCTCAAGCTAACTTGAGGT

Gene: Saro_0953: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Sphingopyxis alaskensis RB2256

Site:
position = -61
score = 4.44719
sequence = ATCTGAACCTCACTTCAGCT

Gene: Sala_2166: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Glyoxalase/bleomycin resistance protein/dioxygenase
nhoA
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0952: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
CRON 2.
nhoA
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
*
Sphingopyxis alaskensis RB2256

Site:
position = -60
score = 5.32751
sequence = ACCTCCACTGCACTTGAGCT

Gene: Sala_2373: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1

Gene: Swit_4676: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Zymomonas mobilis subsp. mobilis ZM4
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
Sala_2372
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2372: Sulfotransferase
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
Sulfotransferase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD