Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654
Oceanicola granulosus HTCC2516 2 2
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM 2 2
Roseovarius sp. 217
Sulfitobacter sp. EE-36 2 2
Silicibacter TM1040 3 3
Silicibacter pomeroyi DSS-3 2 2
Roseobacter sp. MED193 3 3
Hyphomonas neptunium ATCC 15444 2 2
Oceanicaulis alexandrii HTCC2633 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
soxR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
*
Oceanicola granulosus HTCC2516

Site:
position = -36
score = 6.22183
sequence = TTCTCAAGTTAACTTCAGAT

Gene: OG2516_02024: Redox-sensitive transcriptional activator, MerR family
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -36
score = 6.45993
sequence = TTCTCAAGTTAACTTGAGAT

Gene: ISM_04630: Redox-sensitive transcriptional activator, MerR family
 
Roseovarius sp. 217
*
Sulfitobacter sp. EE-36

Site:
position = -38
score = 5.95359
sequence = TTCTAAACCTAAGTTTAGGT

Gene: EE36_04103: Redox-sensitive transcriptional activator, MerR family
*
Silicibacter TM1040

Site:
position = -103
score = 6.07595
sequence = TTCTAAACCTAACTTTAGCT

Gene: TM1040_3746: Redox-sensitive transcriptional activator, MerR family
*
Silicibacter pomeroyi DSS-3

Site:
position = -43
score = 6.07595
sequence = TTCTAAACCTAACTTTAGGT

Gene: SPO0314: Redox-sensitive transcriptional activator, MerR family
*
Roseobacter sp. MED193

Site:
position = -57
score = 6.07595
sequence = TTCTAAACCTAACTTTAGCT

Gene: MED193_10733: Redox-sensitive transcriptional activator, MerR family
*
Hyphomonas neptunium ATCC 15444

Site:
position = -35
score = 6.1795
sequence = ATCTCAAGTTCACTTTAGAT

Gene: HNE_3426: Redox-sensitive transcriptional activator, MerR family
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -54
score = 6.33757
sequence = TTCTCAAGCTAACTTGAGAT

Gene: OA2633_12050: Redox-sensitive transcriptional activator, MerR family
Redox-sensitive transcriptional activator, MerR family
 
CRON 2.
PF00903
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
*
Oceanicola granulosus HTCC2516

Site:
position = -73
score = 6.22183
sequence = ATCTGAAGTTAACTTGAGAA

Gene: OG2516_02029: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -62
score = 6.45993
sequence = ATCTCAAGTTAACTTGAGAA

Gene: ISM_04625: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Roseovarius sp. 217
*
Sulfitobacter sp. EE-36

Site:
position = -69
score = 5.95359
sequence = ACCTAAACTTAGGTTTAGAA

Gene: EE36_04108: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Silicibacter TM1040

Site:
position = -62
score = 6.07595
sequence = AGCTAAAGTTAGGTTTAGAA

Gene: TM1040_3747: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Silicibacter pomeroyi DSS-3

Site:
position = -61
score = 6.07595
sequence = ACCTAAAGTTAGGTTTAGAA

Gene: SPO0313: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Roseobacter sp. MED193

Site:
position = -71
score = 6.07595
sequence = AGCTAAAGTTAGGTTTAGAA

Gene: MED193_10738: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Hyphomonas neptunium ATCC 15444

Site:
position = -66
score = 6.1795
sequence = ATCTAAAGTGAACTTGAGAT

Gene: HNE_3425: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Oceanicaulis alexandrii HTCC2633
Glyoxalase/bleomycin resistance protein/dioxygenase
 
CRON 3.
PF01370
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_0373: NAD-dependent epimerase/dehydratase
 
Silicibacter pomeroyi DSS-3

Gene: SPO2846: NAD-dependent epimerase/dehydratase
*
Roseobacter sp. MED193

Site:
position = -57
score = 6.23756
sequence = AGCTAAAGTTAGCTTTAGAT

Gene: MED193_22126: NAD-dependent epimerase/dehydratase
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
NAD-dependent epimerase/dehydratase
 
CRON 4.
OA2633_12045
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -63
score = 6.33757
sequence = ATCTCAAGTTAGCTTGAGAA

Gene: OA2633_12045: hypothetical protein
hypothetical protein
 
CRON 5.
PF00903
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
*
Silicibacter TM1040

Site:
position = -93
score = 5.75271
sequence = ATCTAAAGTGAGCTTGAGGA

Gene: TM1040_1863: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Silicibacter pomeroyi DSS-3

Gene: SPOA0321: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Glyoxalase/bleomycin resistance protein/dioxygenase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD