Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 4 4
Rhizobium sp. NGR234 3 3
Rhizobium leguminosarum bv. viciae 3841 4 4
Rhizobium etli CFN 42 2 2
Agrobacterium tumefaciens str. C58 (Cereon) 6 4
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099 3 3
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
soxR
*
Sinorhizobium meliloti 1021

Site:
position = -31
score = 6.50664
sequence = ACCTCAACTATAGTTGAGGT

Gene: SMc00182: Redox-sensitive transcriptional activator, MerR family
*
Rhizobium sp. NGR234

Site:
position = -31
score = 6.53382
sequence = ACCTCAAGCTTAGTTGAGGT

Gene: NGR_c16780: Redox-sensitive transcriptional activator, MerR family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -29
score = 6.25286
sequence = ACCTCAACTAATCTTGAGGT

Gene: RL4397: Redox-sensitive transcriptional activator, MerR family
*
Rhizobium etli CFN 42

Site:
position = -29
score = 5.97121
sequence = ACCTCAACTAATATTGAGGT

Gene: RHE_CH03863: Redox-sensitive transcriptional activator, MerR family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -91
score = 6.13279
sequence = ACCTCAACTATAGTTGAGGA

Gene: Atu3915: Redox-sensitive transcriptional activator, MerR family
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -37
score = 6.02992
sequence = AGCTCAACATAACTTGAGGT

Gene: mlr2720: Redox-sensitive transcriptional activator, MerR family
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
*
Xanthobacter autotrophicus Py2

Site:
position = 26
score = 5.63459
sequence = ACCTCGAGTATGGTTTAGGT

Gene: Xaut_1053: Redox-sensitive transcriptional activator, MerR family
Redox-sensitive transcriptional activator, MerR family
 
CRON 2.
PF03358
*
Sinorhizobium meliloti 1021

Site:
position = -67
score = 6.50664
sequence = ACCTCAACTATAGTTGAGGT

Gene: SMc00183: NADPH-dependent FMN reductase
*
Rhizobium sp. NGR234

Site:
position = -68
score = 6.53382
sequence = ACCTCAACTAAGCTTGAGGT

Gene: NGR_c16770: NADPH-dependent FMN reductase
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -74
score = 6.25286
sequence = ACCTCAAGATTAGTTGAGGT

Gene: RL4398: NADPH-dependent FMN reductase
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
NADPH-dependent FMN reductase
 
CRON 3.
PF07690
*
Sinorhizobium meliloti 1021

Site:
position = -62
score = 5.68984
sequence = ACCTCAACCGCGATTGAGGT

Gene: SMc01217: Permease of the major facilitator superfamily
*
Rhizobium sp. NGR234

Site:
position = -63
score = 5.69283
sequence = ACCTCAAGAGCGCTTGAGGT

Gene: NGR_c15730: Permease of the major facilitator superfamily
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -78
score = 5.33207
sequence = ACCTCAATGGCGCTTGAGGT

Gene: Atu0942: Permease of the major facilitator superfamily
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -161
score = 5.57557
sequence = AGCTCAACCGCGGTTGAGGT

Gene: mlr3125: Permease of the major facilitator superfamily
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Permease of the major facilitator superfamily
 
CRON 4.
PF03992
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -63
score = 6.03762
sequence = ACCTCAGGTTAACTTGAGGA

Gene: RL3412: Monooxygenase
*
Rhizobium etli CFN 42

Site:
position = -60
score = 5.98697
sequence = ACCTCAACCATAGTTGAGGA

Gene: RHE_CH02961: Monooxygenase
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -75
score = 6.34985
sequence = ACCTCAACTTAAGTTGAGAT

Gene: mlr7819: Monooxygenase
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Monooxygenase
 
CRON 5.
SMc03095
*
Sinorhizobium meliloti 1021

Site:
position = -59
score = 6.24021
sequence = ACCTCAAGTACGGTTGAGGT

Gene: SMc03095: HYPOTHETICAL UNKNOWN PROTEIN
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
HYPOTHETICAL UNKNOWN PROTEIN
 
CRON 6.
PF07690
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -56
score = 5.98697
sequence = ACCTCAACTATGGTTGAGGA

Gene: Atu2361: Permease of the major facilitator superfamily
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Permease of the major facilitator superfamily
 
CRON 7.
PF00903
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -69
score = 5.98184
sequence = ACCTCAACCGATGTTGAGGT

Gene: RL4165: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Glyoxalase/bleomycin resistance protein/dioxygenase
 
CRON 8.
sodB
 
Sinorhizobium meliloti 1021

Gene: SMc00043: Superoxide dismutase( EC:1.15.1.1 )
 
Rhizobium sp. NGR234

Gene: NGR_c07300: Superoxide dismutase( EC:1.15.1.1 )
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1340: Superoxide dismutase( EC:1.15.1.1 )
 
Rhizobium etli CFN 42

Gene: RHE_CH01203: Superoxide dismutase( EC:1.15.1.1 )
*3
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4726: Superoxide dismutase( EC:1.15.1.1 )

Site:
position = -96
score = 5.81275
sequence = ACCTCAACCGTGATTGAGGT

Gene: Atu4583: Superoxide dismutase( EC:1.15.1.1 )

Gene: Atu0876: Superoxide dismutase( EC:1.15.1.1 )
 
Mesorhizobium sp. BNC1

Gene: Meso_0861: Superoxide dismutase( EC:1.15.1.1 )
 
Mesorhizobium loti MAFF303099

Gene: mlr7636: Superoxide dismutase( EC:1.15.1.1 )
 
Brucella melitensis 16M

Gene: BMEI1367: Superoxide dismutase( EC:1.15.1.1 )
 
Bartonella quintana str. Toulouse

Gene: BQ03820: Superoxide dismutase( EC:1.15.1.1 )
 
Rhodopseudomonas palustris CGA009

Gene: RPA1693: Superoxide dismutase( EC:1.15.1.1 )
 
Bradyrhizobium japonicum USDA 110

Gene: bll7774: Superoxide dismutase( EC:1.15.1.1 )
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1335: Superoxide dismutase( EC:1.15.1.1 )
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0913: Superoxide dismutase( EC:1.15.1.1 )
 2
Azorhizobium caulinodans ORS 571

Gene: AZC_1140: Superoxide dismutase( EC:1.15.1.1 )

Gene: AZC_3053: Superoxide dismutase( EC:1.15.1.1 )
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3319: Superoxide dismutase( EC:1.15.1.1 )
Superoxide dismutase( EC:1.15.1.1 )
fdxA
 
Sinorhizobium meliloti 1021

Gene: SMc03875: 4Fe-4S ferredoxin, iron-sulfur binding
 
Rhizobium sp. NGR234

Gene: NGR_c32680: 4Fe-4S ferredoxin, iron-sulfur binding
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4616: 4Fe-4S ferredoxin, iron-sulfur binding
 
Rhizobium etli CFN 42

Gene: RHE_CH04024: 4Fe-4S ferredoxin, iron-sulfur binding
 2
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4582: 4Fe-4S ferredoxin, iron-sulfur binding

Gene: Atu2751: 4Fe-4S ferredoxin, iron-sulfur binding
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M

Gene: BMEI0278: 4Fe-4S ferredoxin, iron-sulfur binding
 
Bartonella quintana str. Toulouse

Gene: BQ12140: 4Fe-4S ferredoxin, iron-sulfur binding
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
4Fe-4S ferredoxin, iron-sulfur binding
PF01613
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4581: Putative flavin reductase
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Putative flavin reductase
 
CRON 9.
PF00106
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
*
Xanthobacter autotrophicus Py2

Site:
position = -145
score = 5.63459
sequence = ACCTAAACCATACTCGAGGT

Gene: Xaut_1054: short-chain dehydrogenase/reductase SDR
oxidoreductase, short-chain dehydrogenase/reductase family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD