Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 6 3
Acidovorax sp. JS42
Comamonas testosteroni KF-1 3 2
Delftia acidovorans SPH-1 4 3
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666 2 2
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110 2 2
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
soxR
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -61
score = 6.67963
sequence = ACCTCAACTAAACTTGAGGT

Gene: Aave_2276: Redox-sensitive transcriptional activator, MerR family
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -32
score = 6.53382
sequence = ACCTCAACTAAGCTTGAGGT

Gene: CtesDRAFT_3229: Redox-sensitive transcriptional activator, MerR family
*
Delftia acidovorans SPH-1

Site:
position = -72
score = 6.53153
sequence = ACCTCAACCAAAGTTGAGGT

Gene: Daci_1189: Redox-sensitive transcriptional activator, MerR family
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -33
score = 6.67963
sequence = ACCTCAAGTAAAGTTGAGGT

Gene: Bpro_1373: Redox-sensitive transcriptional activator, MerR family
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -32
score = 6.3023
sequence = ACCTCAACTAAAGTCGAGGT

Gene: Vapar_4431: Redox-sensitive transcriptional activator, MerR family
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Redox-sensitive transcriptional activator, MerR family
 
CRON 2.
PF01042
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -85
score = 6.67963
sequence = ACCTCAAGTTTAGTTGAGGT

Gene: Aave_2275: Endoribonuclease L-PSP
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -99
score = 6.53382
sequence = ACCTCAAGCTTAGTTGAGGT

Gene: CtesDRAFT_3230: Endoribonuclease L-PSP
*
Delftia acidovorans SPH-1

Site:
position = -77
score = 6.53153
sequence = ACCTCAACTTTGGTTGAGGT

Gene: Daci_1188: Endoribonuclease L-PSP
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Endoribonuclease L-PSP
PF07690
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2274: Permease of the major facilitator superfamily
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_3231: Permease of the major facilitator superfamily
 
Delftia acidovorans SPH-1

Gene: Daci_1187: Permease of the major facilitator superfamily
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Permease of the major facilitator superfamily
 
CRON 3.
PF03992
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -83
score = 6.67963
sequence = ACCTCAACTTTACTTGAGGT

Gene: Bpro_1374: Monooxygenase
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Monooxygenase
 
CRON 4.
Vapar_4430
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -35
score = 6.20869
sequence = ACCTCAAGTTAGGTTGAGGC

Gene: Vapar_4430: hypothetical protein
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
hypothetical protein
 
CRON 5.
mexE
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -185
score = 5.93405
sequence = ACCTCAACAATGGTTGAGGT

Gene: Aave_1362: RND transporter, membrane fusion protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2010: RND transporter, membrane fusion protein
 
Delftia acidovorans SPH-1

Gene: Daci_5137: RND transporter, membrane fusion protein
 2
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1297: RND transporter, membrane fusion protein

Gene: Pnap_1298: RND transporter, membrane fusion protein
 
Polaromonas sp. JS666

Gene: Bpro_3429: RND transporter, membrane fusion protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_2562: RND transporter, membrane fusion protein
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0869: RND transporter, membrane fusion protein
 
Leptothrix cholodnii SP-6
RND transporter, membrane fusion protein
mexF
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_1363: RND transporter, membrane fusion protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2009: RND transporter, membrane fusion protein
 
Delftia acidovorans SPH-1

Gene: Daci_5136: RND transporter, membrane fusion protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1299: RND transporter, membrane fusion protein
 
Polaromonas sp. JS666

Gene: Bpro_3428: RND transporter, membrane fusion protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_2563: RND transporter, membrane fusion protein
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0868: RND transporter, membrane fusion protein
 
Leptothrix cholodnii SP-6
RND transporter, membrane fusion protein
oprN
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_1364: RND transporter, outer membrane protein
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2008: RND transporter, outer membrane protein
 
Delftia acidovorans SPH-1

Gene: Daci_5135: RND transporter, outer membrane protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1300: RND transporter, outer membrane protein
 
Polaromonas sp. JS666

Gene: Bpro_3427: RND transporter, outer membrane protein
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_2564: RND transporter, outer membrane protein
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A0867: RND transporter, outer membrane protein
 
Leptothrix cholodnii SP-6
RND transporter, outer membrane protein
 
CRON 6.
PF07690
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -45
score = 5.61912
sequence = ATCTCAACCGCACTTGAGGT

Gene: Daci_3895: Permease of the major facilitator superfamily
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Permease of the major facilitator superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD