Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243
Burkholderia mallei ATCC 23344
Burkholderia sp. 383 6 3
Burkholderia cepacia AMMD 3 3
Burkholderia vietnamiensis G4
Burkholderia glumae BGR1 2 2
Burkholderia xenovorans LB400
Burkholderia phymatum STM815
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
soxR
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -42
score = 6.7046
sequence = AGTTGAAGTTAACTTCAAGT

Gene: Bcep18194_B1003: Redox-sensitive transcriptional activator, MerR family
*
Burkholderia cepacia AMMD

Site:
position = -40
score = 6.7046
sequence = AGTTGAAGTTAACTTCAAGT

Gene: Bamb_4130: Redox-sensitive transcriptional activator, MerR family
 
Burkholderia vietnamiensis G4
*
Burkholderia glumae BGR1

Site:
position = -43
score = 6.13044
sequence = GGTTCAAGTAAACTTGAGGT

Gene: bglu_1g22620: Redox-sensitive transcriptional activator, MerR family
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Redox-sensitive transcriptional activator, MerR family
 
CRON 2.
cmeA
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -58
score = 6.7046
sequence = ACTTGAAGTTAACTTCAACT

Gene: Bcep18194_B1004: RND transporter, membrane fusion protein
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
RND transporter, membrane fusion protein
cmeB
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B1005: RND transporter, inner membrane protein
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
RND transporter, inner membrane protein
cmeC
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B1006: RND transporter, outer membrane protein
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
RND transporter, outer membrane protein
 
CRON 3.
Bamb_4129
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
*
Burkholderia cepacia AMMD

Site:
position = -58
score = 6.7046
sequence = ACTTGAAGTTAACTTCAACT

Gene: Bamb_4129: hypothetical protein
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
hypothetical protein
 
CRON 4.
PF07690
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
*
Burkholderia sp. 383

Site:
position = -65
score = 6.28613
sequence = ACTTGAAGTTAACTTCAATT

Gene: Bcep18194_B1327: Permease of the major facilitator superfamily
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Permease of the major facilitator superfamily
PF11811
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383

Gene: Bcep18194_B1328: Protein of unknown function DUF3331
*
Burkholderia cepacia AMMD

Site:
position = -91
score = 6.28613
sequence = ACTTGAAGTTAACTTCAATT

Gene: Bamb_3952: Protein of unknown function DUF3331
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
Protein of unknown function DUF3331
 
CRON 5.
bglu_1g22630
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
*
Burkholderia glumae BGR1

Site:
position = -61
score = 6.13044
sequence = ACCTCAAGTTTACTTGAACC

Gene: bglu_1g22630: hypothetical protein
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD