Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306 3 3
Xanthomonas campestris pv. campestris str. ATCC 33913 2 2
Stenotrophomonas maltophilia K279a 10 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
soxR
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -27
score = 6.2064
sequence = GCCTCAACCTAAGTTGAGGT

Gene: XAC3000: Redox-sensitive transcriptional activator, MerR family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -27
score = 5.88988
sequence = GCCTCAACCAAGGTTGAGGT

Gene: XCC2831: Redox-sensitive transcriptional activator, MerR family
*
Stenotrophomonas maltophilia K279a

Site:
position = -26
score = 6.26083
sequence = ACCTCAACTGCAGTTGAGGT

Gene: Smlt1084: Redox-sensitive transcriptional activator, MerR family
Redox-sensitive transcriptional activator, MerR family
 
CRON 2.
XAC0314
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -54
score = 6.11731
sequence = ACCTCAACTGCGCTTGAGGT

Gene: XAC0314: Oxidative stress resistance protein
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -48
score = 5.86382
sequence = ACCTCAACCATGCTTTAGGT

Gene: XCC0300: Oxidative stress resistance protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt4414: Oxidative stress resistance protein
Oxidative stress resistance protein
 
CRON 3.
sodA
 
Xylella fastidiosa 9a5c

Gene: XF2614: Manganese superoxide dismutase (EC 1.15.1.1)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2386: Manganese superoxide dismutase (EC 1.15.1.1)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2278: Manganese superoxide dismutase (EC 1.15.1.1)
*2
Stenotrophomonas maltophilia K279a

Site:
position = -76
score = 6.10475
sequence = ACCTCAACCAATGTTGAGGT

Gene: Smlt2828: Manganese superoxide dismutase (EC 1.15.1.1)

Gene: Smlt3238: Manganese superoxide dismutase (EC 1.15.1.1)
Manganese superoxide dismutase (EC 1.15.1.1)
PF01613
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2829: Putative flavin reductase
Putative flavin reductase
Smlt2830
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2830: Tetratricopeptide repeat protein
Tetratricopeptide repeat protein
 
CRON 4.
mexE
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1482: RND transporter, membrane fusion protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1439: RND transporter, membrane fusion protein
*
Stenotrophomonas maltophilia K279a

Site:
position = -140
score = 5.83997
sequence = ACCTCGACCATGGTTGAGGT

Gene: Smlt1830: RND transporter, membrane fusion protein
RND transporter, membrane fusion protein
mexF
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1483: RND transporter, membrane fusion protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1440: RND transporter, membrane fusion protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1831: RND transporter, membrane fusion protein
RND transporter, membrane fusion protein
PF00106
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1484: oxidoreductase, short-chain dehydrogenase/reductase family
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1441: oxidoreductase, short-chain dehydrogenase/reductase family
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1832: oxidoreductase, short-chain dehydrogenase/reductase family
oxidoreductase, short-chain dehydrogenase/reductase family
oprN
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1485: RND transporter, outer membrane protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1442: RND transporter, outer membrane protein
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1833: RND transporter, outer membrane protein
RND transporter, outer membrane protein
 
CRON 5.
PF01042
 
Xylella fastidiosa 9a5c
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -55
score = 5.80497
sequence = ACCTCAACCGGGGTTGAGGT

Gene: Smlt2940: Endoribonuclease L-PSP
Endoribonuclease L-PSP
 
CRON 6.
PF07690
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -92
score = 6.2064
sequence = ACCTCAACTTAGGTTGAGGC

Gene: XAC3001: Permease of the major facilitator superfamily
 
Xanthomonas campestris pv. campestris str. ATCC 33913
*
Stenotrophomonas maltophilia K279a

Site:
position = -23
score = 6.26083
sequence = ACCTCAACTGCAGTTGAGGT

Gene: Smlt1083: Permease of the major facilitator superfamily
Permease of the major facilitator superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD