Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 2 1
Acinetobacter baumannii AB0057 2 1
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF01042
*
Acinetobacter sp. ADP1

Site:
position = -13
score = 6.45899
sequence = ACCTCAAGTTAACTTGAGCT

Gene: ACIAD3083: Endoribonuclease L-PSP
*
Acinetobacter baumannii AB0057

Site:
position = -58
score = 6.84804
sequence = ACCTCAACTTAAGTTGAGGT

Gene: AB57_0668: Endoribonuclease L-PSP
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Endoribonuclease L-PSP
PF07690
 
Acinetobacter sp. ADP1

Gene: ACIAD3084: Permease of the major facilitator superfamily
 
Acinetobacter baumannii AB0057

Gene: AB57_0667: Permease of the major facilitator superfamily
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Permease of the major facilitator superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD