Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 7 4
Pseudomonas entomophila L48 3 3
Pseudomonas putida KT2440 7 5
Pseudomonas syringae pv. tomato str. DC3000
Pseudomonas fluorescens Pf-5 2 2
Pseudomonas mendocina ymp 2 2
Pseudomonas stutzeri A1501
Azotobacter vinelandii AvOP
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF03992
*
Pseudomonas aeruginosa PAO1

Site:
position = -67
score = 6.39984
sequence = ACCTCAAGTTTGCTTGAGGT

Gene: PA2274: Monooxygenase
*
Pseudomonas entomophila L48

Site:
position = -71
score = 6.29081
sequence = ACCTTGAGTTAACTGGAGGT

Gene: PSEEN3529: Monooxygenase
*
Pseudomonas putida KT2440

Site:
position = -71
score = 6.14979
sequence = ACCTTGACTTTACTTGAGGT

Gene: PP2235: Monooxygenase
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -78
score = 6.12396
sequence = ACCTTGACTTAACTAGAGGT

Gene: PFL_4159: Monooxygenase
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Monooxygenase
 
CRON 2.
PF01042
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -59
score = 6.26331
sequence = ACCTCGACTTAACCCGAGGT

Gene: PSEEN2338: Endoribonuclease L-PSP
*
Pseudomonas putida KT2440

Site:
position = -60
score = 6.63583
sequence = ACCTCGAGTTAACTTAAGGT

Gene: PP3522: Endoribonuclease L-PSP
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_3684: Endoribonuclease L-PSP
 
Azotobacter vinelandii AvOP
Endoribonuclease L-PSP
 
CRON 3.
mexG
*
Pseudomonas aeruginosa PAO1

Site:
position = -125
score = 6.87137
sequence = ACCTCAACTTAACTTGAGGT

Gene: PA4205: Membrane protein
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Membrane protein
mexH
 
Pseudomonas aeruginosa PAO1

Gene: PA4206: RND transporter, membrane fusion protein
 
Pseudomonas entomophila L48

Gene: PSEEN4758: RND transporter, membrane fusion protein
*
Pseudomonas putida KT2440

Site:
position = -76
score = 6.23299
sequence = ACCTCAAGTAAAGTTGAGCT

Gene: PP2064: RND transporter, membrane fusion protein
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1029: RND transporter, membrane fusion protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
RND transporter, membrane fusion protein
mexI
 
Pseudomonas aeruginosa PAO1

Gene: PA4207: RND transporter, membrane fusion protein
 
Pseudomonas entomophila L48

Gene: PSEEN4757: RND transporter, membrane fusion protein
 
Pseudomonas putida KT2440

Gene: PP2065: RND transporter, membrane fusion protein
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_1028: RND transporter, membrane fusion protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
RND transporter, membrane fusion protein
opmD
 
Pseudomonas aeruginosa PAO1

Gene: PA4208: RND transporter, outer membrane protein
 
Pseudomonas entomophila L48

Gene: PSEEN4756: RND transporter, outer membrane protein
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
RND transporter, outer membrane protein
 
CRON 4.
PF07690
*
Pseudomonas aeruginosa PAO1

Site:
position = -83
score = 6.71903
sequence = ACCTCAAGTTAACTTGAGCT

Gene: PA3718: Permease of the major facilitator superfamily
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Permease of the major facilitator superfamily
 
CRON 5.
PF03358
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -63
score = 6.61342
sequence = ACCTTAAGTTAAGTTGAGGT

Gene: Pmen_1342: NADPH-dependent FMN reductase
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
NADPH-dependent FMN reductase
 
CRON 6.
PF09933
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
*
Pseudomonas putida KT2440

Site:
position = -26
score = 6.32455
sequence = ACCTCGAGTTAAGTCAAGGT

Gene: PP2506: Membrane protein
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0497: Membrane protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Membrane protein
PF00106
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN4636: oxidoreductase, short-chain dehydrogenase/reductase family
 
Pseudomonas putida KT2440

Gene: PP2507: oxidoreductase, short-chain dehydrogenase/reductase family
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_1897: oxidoreductase, short-chain dehydrogenase/reductase family
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
oxidoreductase, short-chain dehydrogenase/reductase family
 
CRON 7.
soxR
*
Pseudomonas aeruginosa PAO1

Site:
position = -30
score = 6.39984
sequence = ACCTCAAGCAAACTTGAGGT

Gene: PA2273: Redox-sensitive transcriptional activator, MerR family
*
Pseudomonas entomophila L48

Site:
position = -34
score = 6.29081
sequence = ACCTCCAGTTAACTCAAGGT

Gene: PSEEN3530: Redox-sensitive transcriptional activator, MerR family
*
Pseudomonas putida KT2440

Site:
position = -29
score = 6.01523
sequence = AGCTCAACTTAACTTTAGGT

Gene: PP2060: Redox-sensitive transcriptional activator, MerR family
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -50
score = 6.12396
sequence = ACCTCTAGTTAAGTCAAGGT

Gene: PFL_4160: Redox-sensitive transcriptional activator, MerR family
*
Pseudomonas mendocina ymp

Site:
position = -35
score = 6.61342
sequence = ACCTCAACTTAACTTAAGGT

Gene: Pmen_1341: Redox-sensitive transcriptional activator, MerR family
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Redox-sensitive transcriptional activator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD