Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36 1 1
Aeromonas hydrophila subsp. hydrophila ATCC 7966 1 1
Aeromonas salmonicida subsp. salmonicida A449 1 1
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF07690
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -141
score = 6.42356
sequence = ACCTCAACATAACTTGAGGT

Gene: PE36_09311: Permease of the major facilitator superfamily
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Permease of the major facilitator superfamily
 
CRON 2.
AHA_2711
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -61
score = 5.3425
sequence = ACCTCAAGTTAGCTTTAACT

Gene: AHA_2711: hypothetical protein
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -55
score = 5.3425
sequence = ACCTCAAGTTAGCTTTAACT

Gene: ASA_1662: hypothetical protein
 
Tolumonas auensis DSM 9187
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD