Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 1 1
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H
Alteromonadales bacterium TW-7 1 1
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2 1 1
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF00903
*
Pseudoalteromonas atlantica T6c

Site:
position = -66
score = 5.00345
sequence = ATCTAAAGTTAGCTTTAGAT

Gene: Patl_1581: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Glyoxalase/bleomycin resistance protein/dioxygenase
 
CRON 2.
PF03358
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -58
score = 6.1442
sequence = ACCTCAATATAACTTGAGGT

Gene: ATW7_01927: NADPH-dependent FMN reductase
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
NADPH-dependent FMN reductase
 
CRON 3.
nhoA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_2729: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -186
score = 6.42585
sequence = ACCTCAAGTTATCTTGAGGT

Gene: PTD2_05755: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD