Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 2 2
Vibrio vulnificus CMCP6 5 4
Vibrio harveyi ATCC BAA-1116 4 4
Vibrio parahaemolyticus RIMD 2210633 5 5
Vibrio shilonii AK1 3 3
Vibrio splendidus LGP32 1 1
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14 3 3
Photobacterium profundum SS9 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF00903
 
Vibrio cholerae O1 biovar eltor str. N16961
*2
Vibrio vulnificus CMCP6

Gene: VV20606: Glyoxalase/bleomycin resistance protein/dioxygenase

Site:
position = -58
score = 6.80665
sequence = ACCTCAATTTAACTTGAGGT

Gene: VV20607: Glyoxalase/bleomycin resistance protein/dioxygenase
*2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06892: Glyoxalase/bleomycin resistance protein/dioxygenase

Site:
position = -67
score = 6.56793
sequence = ACCTTAACTTAACTTGAGGT

Gene: VIBHAR_04755: Glyoxalase/bleomycin resistance protein/dioxygenase
*3
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -67
score = 6.3741
sequence = ACCTCGATTTAACTTGAGGT

Gene: VPA1685: Glyoxalase/bleomycin resistance protein/dioxygenase

Gene: VPA0104: Glyoxalase/bleomycin resistance protein/dioxygenase

Site:
position = -69
score = 6.51383
sequence = ACCTAAACTTAGCTTGAGGT

Gene: VPA0391: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Vibrio shilonii AK1

Site:
position = -60
score = 6.68062
sequence = ACCTCAAGTTAACTTGAGGA

Gene: VSAK1_17857: Glyoxalase/bleomycin resistance protein/dioxygenase
*
Vibrio splendidus LGP32

Site:
position = -28
score = 6.97326
sequence = ACCTCAACTTAACTTGAGGT

Gene: VS_II1117: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -60
score = 5.90098
sequence = ACCTCAAGTTTACTCGAGGA

Gene: VAS14_15449: Glyoxalase/bleomycin resistance protein/dioxygenase
 
Photobacterium profundum SS9
Glyoxalase/bleomycin resistance protein/dioxygenase
 
CRON 2.
PF07690
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -60
score = 6.86171
sequence = ACCTAAAGTTAACTTGAGGT

Gene: VCA0085: Permease of the major facilitator superfamily
*
Vibrio vulnificus CMCP6

Site:
position = -68
score = 6.61952
sequence = ACCTCAAGTTAAGTTGAGCT

Gene: VV20937: Permease of the major facilitator superfamily
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -160
score = 6.75971
sequence = ACCTCAAGTTTACTTGAGGT

Gene: VPA0333: Permease of the major facilitator superfamily
*
Vibrio shilonii AK1

Site:
position = -59
score = 6.08593
sequence = ACCTCAAGTAATGTTGAGGT

Gene: VSAK1_19654: Permease of the major facilitator superfamily
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -62
score = 6.24807
sequence = ACCTCAAGTTAACCTGAGGC

Gene: PBPRB1506: Permease of the major facilitator superfamily
Permease of the major facilitator superfamily
 
CRON 3.
wrbA
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -80
score = 6.68062
sequence = ACCTCAAGTTAACTTGAGGA

Gene: VV21129: Multimeric flavodoxin
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -152
score = 6.54456
sequence = ACCTCAACCTAGCTTGAGGT

Gene: VIBHAR_07059: Multimeric flavodoxin
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -70
score = 6.16674
sequence = ACCTAAACCAAACTTGAGGT

Gene: VPA1738: Multimeric flavodoxin
 
Vibrio shilonii AK1

Gene: VSAK1_13932: Multimeric flavodoxin
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -63
score = 6.67424
sequence = ACCTCAGGTTAACTTGAGGT

Gene: VAS14_10824: Multimeric flavodoxin
 
Photobacterium profundum SS9
Multimeric flavodoxin
 
CRON 4.
nhoA
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -64
score = 6.20586
sequence = ACCTCAACTTCGGTTGAGGT

Gene: VIBHAR_06924: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0072: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Vibrio shilonii AK1

Gene: VSAK1_14037: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
*
Vibrio angustum S14

Site:
position = -89
score = 6.41219
sequence = ACCTCAACTTAACTTGAGGG

Gene: VAS14_11599: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
Photobacterium profundum SS9
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
 
CRON 5.
soxR
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -138
score = 6.86171
sequence = ACCTCAAGTTAACTTTAGGT

Gene: VCA0084: Redox-sensitive transcriptional activator, MerR family
*
Vibrio vulnificus CMCP6

Site:
position = -80
score = 6.61952
sequence = AGCTCAACTTAACTTGAGGT

Gene: VV20936: Redox-sensitive transcriptional activator, MerR family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -48
score = 6.26111
sequence = ACCTCAAGTGAACTTGAGGA

Gene: VIBHAR_06555: Redox-sensitive transcriptional activator, MerR family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -60
score = 6.75971
sequence = ACCTCAAGTAAACTTGAGGT

Gene: VPA0335: Redox-sensitive transcriptional activator, MerR family
*
Vibrio shilonii AK1

Site:
position = -52
score = 6.08593
sequence = ACCTCAACATTACTTGAGGT

Gene: VSAK1_19649: Redox-sensitive transcriptional activator, MerR family
 
Vibrio splendidus LGP32

Gene: VS_2133: Redox-sensitive transcriptional activator, MerR family
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0225: Redox-sensitive transcriptional activator, MerR family
 
Vibrio angustum S14

Gene: VAS14_15499: Redox-sensitive transcriptional activator, MerR family
*
Photobacterium profundum SS9

Site:
position = -46
score = 6.24807
sequence = GCCTCAGGTTAACTTGAGGT

Gene: PBPRB1505: Redox-sensitive transcriptional activator, MerR family
Redox-sensitive transcriptional activator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD