Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SoxR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000
Ralstonia pickettii 12J
Ralstonia metallidurans CH34 1 1
Ralstonia eutropha JMP134
Ralstonia eutropha H16 1 1
Cupriavidus taiwanensis 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF01042
 
Ralstonia solanacearum GMI1000
 
Ralstonia pickettii 12J
*
Ralstonia metallidurans CH34

Site:
position = -56
score = 6.09669
sequence = ACCTCAAGCGTGCTTGAGGT

Gene: Rmet_4539: Endoribonuclease L-PSP
 
Ralstonia eutropha JMP134
*
Ralstonia eutropha H16

Site:
position = -73
score = 6.42286
sequence = ACCTCAATTTAGGTTGAGGT

Gene: H16_B2318: Endoribonuclease L-PSP
*
Cupriavidus taiwanensis

Site:
position = -151
score = 6.29825
sequence = ACCTTAACCTAACTTGAGGT

Gene: RALTA_B2082: Endoribonuclease L-PSP
Endoribonuclease L-PSP
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD