Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PsiR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Psicose utilization
Effector: Psicose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 8 2
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42
Rhizobium leguminosarum bv. viciae 3841 6 2
Rhizobium sp. NGR234 8 2
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021 8 2
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
psiA
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -288
score = 6.40198
sequence = TTGCACCATCGATTGTGCAG

Site:
position = -266
score = 5.81251
sequence = TGGCAATATCGATTGTGCAT

Gene: Atu4744: Predicted psicose ABC transporter, substrate-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -149
score = 5.27024
sequence = AAGAAAGATCGATTGTGCAA

Site:
position = -171
score = 6.64981
sequence = TTGCACCATCGATTGTGCAA

Gene: pRL120191: Predicted psicose ABC transporter, substrate-binding protein
*
Rhizobium sp. NGR234

Site:
position = -173
score = 6.64981
sequence = TTGCACCATCGATTGTGCAA

Site:
position = -151
score = 5.18165
sequence = AAGAAATATCGATTGTGCAG

Gene: NGR_b11530: Predicted psicose ABC transporter, substrate-binding protein
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -151
score = 5.42948
sequence = AAGAAATATCGATTGTGCAA

Site:
position = -173
score = 6.64981
sequence = TTGCACCATCGATTGTGCAA

Gene: SMb20484: Predicted psicose ABC transporter, substrate-binding protein
 
Xanthobacter autotrophicus Py2
Predicted psicose ABC transporter, substrate-binding protein
psiB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4745: Predicted psicose ABC transporter, ATP-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120192: Predicted psicose ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_b11540: Predicted psicose ABC transporter, ATP-binding protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb20485: Predicted psicose ABC transporter, ATP-binding protein
 
Xanthobacter autotrophicus Py2
Predicted psicose ABC transporter, ATP-binding protein
psiC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4746: Predicted psicose ABC transporter, inner membrane protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120193: Predicted psicose ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_b11550: Predicted psicose ABC transporter, inner membrane protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb20486: Predicted psicose ABC transporter, inner membrane protein
 
Xanthobacter autotrophicus Py2
Predicted psicose ABC transporter, inner membrane protein
psiD
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4747: Predicted psicose ABC transporter, inner membrane protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120194: Predicted psicose ABC transporter, inner membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_b11560: Predicted psicose ABC transporter, inner membrane protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb20487: Predicted psicose ABC transporter, inner membrane protein
 
Xanthobacter autotrophicus Py2
Predicted psicose ABC transporter, inner membrane protein
psiE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4748: Fructose:psicose-3-epimerase (EC 5.3.1.-)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120195: Fructose:psicose-3-epimerase (EC 5.3.1.-)
 
Rhizobium sp. NGR234

Gene: NGR_b11570: Fructose:psicose-3-epimerase (EC 5.3.1.-)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb20488: Fructose:psicose-3-epimerase (EC 5.3.1.-)
 
Xanthobacter autotrophicus Py2
Fructose:psicose-3-epimerase (EC 5.3.1.-)
frcK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4749: Fructokinase FrcK (EC 2.7.1.4)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEI1883: Fructokinase FrcK (EC 2.7.1.4)
 
Mesorhizobium loti MAFF303099

Gene: mll4957: Fructokinase FrcK (EC 2.7.1.4)
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH00468: Fructokinase FrcK (EC 2.7.1.4)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0492: Fructokinase FrcK (EC 2.7.1.4)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Fructokinase FrcK (EC 2.7.1.4)
dpe
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4750: D-psicose 3-epimerase
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
D-psicose 3-epimerase
psiK
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b11580: Predicted fructokinase, FGGY family
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb20489: Predicted fructokinase, FGGY family
 
Xanthobacter autotrophicus Py2
Predicted fructokinase, FGGY family
fucA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_b11590: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMb20490: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
 
Xanthobacter autotrophicus Py2
Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
 
CRON 2.
psiR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -116
score = 5.81251
sequence = ATGCACAATCGATATTGCCA

Site:
position = -94
score = 6.40198
sequence = CTGCACAATCGATGGTGCAA

Gene: Atu4743: Predicted transcriptional regulator for psicose utilization, LacI family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -116
score = 5.27024
sequence = TTGCACAATCGATCTTTCTT

Site:
position = -94
score = 6.64981
sequence = TTGCACAATCGATGGTGCAA

Gene: pRL120189: Predicted transcriptional regulator for psicose utilization, LacI family
*
Rhizobium sp. NGR234

Site:
position = -109
score = 5.18165
sequence = CTGCACAATCGATATTTCTT

Site:
position = -87
score = 6.64981
sequence = TTGCACAATCGATGGTGCAA

Gene: NGR_b11520: Predicted transcriptional regulator for psicose utilization, LacI family
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -142
score = 5.42948
sequence = TTGCACAATCGATATTTCTT

Site:
position = -120
score = 6.64981
sequence = TTGCACAATCGATGGTGCAA

Gene: SMb20483: Predicted transcriptional regulator for psicose utilization, LacI family
 
Xanthobacter autotrophicus Py2
Predicted transcriptional regulator for psicose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD