Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RhiR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Rhamnogalacturonides utilization
Effector: Rhamogalacturonate oligosaccharides
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 7 2
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42 7 2
Rhizobium leguminosarum bv. viciae 3841 7 2
Rhizobium sp. NGR234 7 2
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rhiX
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -183
score = 6.22034
sequence = CAATGAAAACATTTTCACAA

Site:
position = -43
score = 6.24835
sequence = TCGTGAAAATAATTTCATTA

Gene: Atu4562: hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -214
score = 6.19535
sequence = CCATGAAAACATTTTCATCA

Site:
position = -73
score = 5.93598
sequence = GAATGAAAAGATTTTCATGC

Gene: RHE_PF00296: hypothetical protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -180
score = 6.45561
sequence = CCATGAAAACATTTTCATTA

Site:
position = -40
score = 6.53264
sequence = TAATGAAAATATTTTCATAG

Gene: pRL120686: hypothetical protein
*
Rhizobium sp. NGR234

Site:
position = -182
score = 5.90161
sequence = TCATGAAAACTTTTTCATAA

Site:
position = -39
score = 5.99589
sequence = TGATGAAAACATTTTCATAC

Gene: NGR_b17680: hypothetical protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
hypothetical protein
rhiN
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4561: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00295: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120687: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Rhizobium sp. NGR234

Gene: NGR_b17690: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
pgl
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4560: Polygalacturonase (EC 3.2.1.15)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00294: Polygalacturonase (EC 3.2.1.15)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120688: Polygalacturonase (EC 3.2.1.15)
 
Rhizobium sp. NGR234

Gene: NGR_b17700: Polygalacturonase (EC 3.2.1.15)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Polygalacturonase (EC 3.2.1.15)
rhiK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4559: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00293: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120689: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_b17710: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
rhiG
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4558: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00292: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120690: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Rhizobium sp. NGR234

Gene: NGR_b17720: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putatuve rhamnogalacturonides ABC transporter, permease component 2
rhiF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4557: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00291: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120691: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Rhizobium sp. NGR234

Gene: NGR_b17730: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
CRON 2.
rhiL
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -171
score = 6.24835
sequence = TAATGAAATTATTTTCACGA

Site:
position = -31
score = 6.22034
sequence = TTGTGAAAATGTTTTCATTG

Gene: Atu4564: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -171
score = 5.93598
sequence = GCATGAAAATCTTTTCATTC

Site:
position = -30
score = 6.19535
sequence = TGATGAAAATGTTTTCATGG

Gene: RHE_PF00297: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -164
score = 6.53264
sequence = CTATGAAAATATTTTCATTA

Site:
position = -24
score = 6.45561
sequence = TAATGAAAATGTTTTCATGG

Gene: pRL120685: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
*
Rhizobium sp. NGR234

Site:
position = -175
score = 5.99589
sequence = GTATGAAAATGTTTTCATCA

Site:
position = -32
score = 5.90161
sequence = TTATGAAAAAGTTTTCATGA

Gene: NGR_b17670: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD