Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR2 - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 6 1
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42
Rhizobium leguminosarum bv. viciae 3841 9 1
Rhizobium sp. NGR234
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR2
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -86
score = 6.28363
sequence = CTTGTAAACCGGTTTAGTAA

Site:
position = -73
score = 6.23473
sequence = TTAGTAAATCGCTTTACAAA

Gene: Atu3062: Transcriptional repressor of ribose utilization, LacI family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -44
score = 6.23737
sequence = CTTGTAAAGCGCTTTACTAA

Site:
position = -31
score = 5.95978
sequence = TTACTAAACCGCTTTACAAT

Gene: pRL90226: Transcriptional repressor of ribose utilization, LacI family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Transcriptional repressor of ribose utilization, LacI family
rbsA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3063: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7668: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90225: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Ribose ABC transporter, periplasmic ribose-binding protein rbsA
rbsB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3064: Ribose ABC transporter, ATP-binding protein rbsB
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7666: Ribose ABC transporter, ATP-binding protein rbsB
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90224: Ribose ABC transporter, ATP-binding protein rbsB
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Ribose ABC transporter, ATP-binding protein rbsB
rbsC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3065: Ribose ABC transporter, inner membrane protein rbsC
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7665: Ribose ABC transporter, inner membrane protein rbsC
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90223: Ribose ABC transporter, inner membrane protein rbsC
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Ribose ABC transporter, inner membrane protein rbsC
COG1735
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3066: phosphotriesterase-like protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7664: phosphotriesterase-like protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90222: phosphotriesterase-like protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
phosphotriesterase-like protein
COG5426
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3067: Uncharacterized membrane protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7663: Uncharacterized membrane protein
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90221: Uncharacterized membrane protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Uncharacterized membrane protein
SSF51366
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7660: Ribulose-phosphate binding barrel
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90220: Ribulose-phosphate binding barrel
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Ribulose-phosphate binding barrel
tenA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90219: Thiaminase II (EC 3.5.99.2)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Thiaminase II (EC 3.5.99.2)
rbsK
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll7662: Ribokinase (EC 2.7.1.15)
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90218: Ribokinase (EC 2.7.1.15)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Ribokinase (EC 2.7.1.15)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD