Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510 2 2
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5 2 2
Acetobacter pasteurianus IFO 3283-01 2 2
Gluconobacter oxydans 621H 2 2
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntR
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = 16
score = 3.68547
sequence = AGTATGCAAGGCGCTATACT

Gene: AZL_b04530: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -179
score = 5.13522
sequence = AATATGCAATAAGCTATATG

Gene: Gdia_1353: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -157
score = 5.68271
sequence = AATATGCAATATGCTATATT

Site:
position = -64
score = 5.5639
sequence = TTTATTCTTTATGGAATATT

Gene: APA01_40860: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Gluconobacter oxydans 621H

Site:
position = -140
score = 5.63906
sequence = AATATTCAACATGCTATATT

Site:
position = -49
score = 4.61587
sequence = TTTATTCCGCCGTGAATAAT

Gene: GOX2068: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Granulibacter bethesdensis CGDNIH1
Manganese homeostasis transcriptional regulator MntR, DtxR family
 
CRON 2.
mntH
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03007105: Manganese transporter, NRAMP family
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = -114
score = 3.68547
sequence = AGTATAGCGCCTTGCATACT

Gene: AZL_b04520: Manganese transporter, NRAMP family
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = 16
score = 5.13522
sequence = CATATAGCTTATTGCATATT

Gene: Gdia_1352: Manganese transporter, NRAMP family
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -141
score = 5.5639
sequence = AATATTCCATAAAGAATAAA

Site:
position = -48
score = 5.68271
sequence = AATATAGCATATTGCATATT

Gene: APA01_40840: Manganese transporter, NRAMP family
*
Gluconobacter oxydans 621H

Site:
position = -28
score = 5.63906
sequence = AATATAGCATGTTGAATATT

Site:
position = -119
score = 4.61587
sequence = ATTATTCACGGCGGAATAAA

Gene: GOX2067: Manganese transporter, NRAMP family
 
Granulibacter bethesdensis CGDNIH1
Manganese transporter, NRAMP family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD