Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654 3 2
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM 3 2
Roseovarius sp. 217 1 1
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -77
score = 6.46305
sequence = AAAGTTAGACATGGCTAACTTA

Gene: RB2654_22338: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -70
score = 5.3924
sequence = AAAGTTAGCTTCGGCTAATAAT

Gene: ISM_17630: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Roseovarius sp. 217

Site:
position = -77
score = 6.27131
sequence = AAAGTTAGACATGGCTAATTTA

Gene: ROS217_03050: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Manganese homeostasis transcriptional regulator MntR, DtxR family
 
CRON 2.
COG2132
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
*
Rhodobacterales bacterium HTCC2654

Site:
position = -98
score = 4.61516
sequence = GGAGTTAAAAGATGCTGACTCG

Gene: RB2654_12814: Putative metal oxidase
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
*
Roseovarius nubinhibens ISM

Site:
position = -278
score = 5.3924
sequence = ATTATTAGCCGAAGCTAACTTT

Gene: ISM_17635: Putative metal oxidase
 
Roseovarius sp. 217

Gene: ROS217_10017: Putative metal oxidase
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Putative metal oxidase
COG0428
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_12809: Putative metal cation transporter
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM

Gene: ISM_17640: Putative metal cation transporter
 
Roseovarius sp. 217

Gene: ROS217_10012: Putative metal cation transporter
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Putative metal cation transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD