Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021
Rhizobium sp. NGR234 3 2
Rhizobium leguminosarum bv. viciae 3841
Rhizobium etli CFN 42
Agrobacterium tumefaciens str. C58 (Cereon)
Mesorhizobium sp. BNC1 4 2
Mesorhizobium loti MAFF303099 2 2
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1 2 2
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntR
 
Sinorhizobium meliloti 1021
*
Rhizobium sp. NGR234

Site:
position = -141
score = 6.2332
sequence = AATATAGCAAGTGCTATAAT

Site:
position = -61
score = 5.8004
sequence = AAAATAGCCTTAGCTATATT

Gene: NGR_b14390: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -46
score = 5.05211
sequence = TCCATAGCCGAGGCTATAAT

Site:
position = -109
score = 5.82851
sequence = ATTATAGCAAATGCTATTTC

Gene: Meso_4423: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Mesorhizobium loti MAFF303099

Site:
position = -55
score = 5.19417
sequence = ATCAGAGCCCGTGCTATAAA

Gene: mll2499: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -127
score = 5.44598
sequence = GATATAGCTTCTGCTACATT

Gene: BBta_1555: Manganese homeostasis transcriptional regulator MntR, DtxR family
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Manganese homeostasis transcriptional regulator MntR, DtxR family
 
CRON 2.
mntH
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0940: Manganese transporter, NRAMP family
 
Rhizobium etli CFN 42

Gene: RHE_CH00878: Manganese transporter, NRAMP family
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1736: Manganese transporter, NRAMP family
 
Mesorhizobium sp. BNC1

Gene: Meso_4120: Manganese transporter, NRAMP family
*
Mesorhizobium loti MAFF303099

Site:
position = -195
score = 5.19417
sequence = TTTATAGCACGGGCTCTGAT

Gene: mlr2501: Manganese transporter, NRAMP family
 
Brucella melitensis 16M

Gene: BMEI0569: Manganese transporter, NRAMP family
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA2706: Manganese transporter, NRAMP family
 
Bradyrhizobium japonicum USDA 110

Gene: bll5044: Manganese transporter, NRAMP family
*2
Bradyrhizobium sp. BTAi1

Site:
position = -92
score = 5.44598
sequence = AATGTAGCAGAAGCTATATC

Gene: BBta_1556: Manganese transporter, NRAMP family

Gene: BBta_4658: Manganese transporter, NRAMP family
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1912: Manganese transporter, NRAMP family
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3295: Manganese transporter, NRAMP family
 
Xanthobacter autotrophicus Py2
Manganese transporter, NRAMP family
 
CRON 3.
COG2132
 
Sinorhizobium meliloti 1021
*
Rhizobium sp. NGR234

Site:
position = -153
score = 5.8004
sequence = AATATAGCTAAGGCTATTTT

Site:
position = -73
score = 6.2332
sequence = ATTATAGCACTTGCTATATT

Gene: NGR_b14380: Putative metal oxidase
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
*
Mesorhizobium sp. BNC1

Site:
position = -73
score = 5.82851
sequence = GAAATAGCATTTGCTATAAT

Site:
position = -136
score = 5.05211
sequence = ATTATAGCCTCGGCTATGGA

Gene: Meso_4422: Putative metal oxidase
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3971: Putative metal oxidase
Putative metal oxidase
COG0428
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234

Gene: NGR_b14370: Putative metal cation transporter
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4421: Putative metal cation transporter
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3970: Putative metal cation transporter
Putative metal cation transporter
cycX
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1

Gene: Meso_4420: Cytochrome c556
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Cytochrome c556
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD