Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c 2 2
Xanthomonas axonopodis pv. citri str. 306 2 2
Xanthomonas campestris pv. campestris str. ATCC 33913 2 2
Stenotrophomonas maltophilia K279a 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntR
*
Xylella fastidiosa 9a5c

Site:
position = -193
score = 5.62916
sequence = CTTATAGCATTGGCTATACC

Gene: XF1013: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -113
score = 6.2331
sequence = GATATAGCAGTTGCTATGCT

Gene: XAC2037: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -113
score = 6.2331
sequence = GATATAGCAAGTGCTATGCT

Gene: XCC2170: Manganese homeostasis transcriptional regulator MntR, DtxR family
*
Stenotrophomonas maltophilia K279a

Site:
position = -110
score = 5.93778
sequence = AATATAGCTCCTGCTATAGT

Gene: Smlt2837: Manganese homeostasis transcriptional regulator MntR, DtxR family
Manganese homeostasis transcriptional regulator MntR, DtxR family
 
CRON 2.
mntH
*
Xylella fastidiosa 9a5c

Site:
position = 9
score = 5.62916
sequence = GGTATAGCCAATGCTATAAG

Gene: XF1015: Manganese transporter, NRAMP family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -49
score = 6.2331
sequence = AGCATAGCAACTGCTATATC

Gene: XAC2036: Manganese transporter, NRAMP family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -50
score = 6.2331
sequence = AGCATAGCACTTGCTATATC

Gene: XCC2171: Manganese transporter, NRAMP family
*
Stenotrophomonas maltophilia K279a

Site:
position = -27
score = 5.93778
sequence = ACTATAGCAGGAGCTATATT

Gene: Smlt2838: Manganese transporter, NRAMP family
Manganese transporter, NRAMP family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD