Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510 5 2
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntR
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = -114
score = 6.17799
sequence = CGATGTAAGCGCTTACATAG

Site:
position = -47
score = 5.45415
sequence = ATATGTAACCGCTTTCAAAA

Gene: AZL_a08610: Gluconate utilization transcriptional regulator GntR, LacI family
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Gluconate utilization transcriptional regulator GntR, LacI family
 
CRON 2.
gntK
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
*
Azospirillum sp. B510

Site:
position = -138
score = 5.58386
sequence = CAAGGTTAGCGCTAACAGTA

Site:
position = -48
score = 6.08558
sequence = TCATGATAGCGCTAACATAA

Gene: AZL_d00380: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Thermoresistant gluconokinase (EC 2.7.1.12)
gntZ
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_d00390: Predicted gluconate TRAP family transporter, DctM subunit
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Predicted gluconate TRAP family transporter, DctM subunit
gntY
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_d00400: Predicted gluconate TRAP family transporter, DctQ subunit
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Predicted gluconate TRAP family transporter, DctQ subunit
gntX
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_d00410: Predicted gluconate TRAP family transporter, DctP subunit
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Predicted gluconate TRAP family transporter, DctP subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD