Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 5 2
Acidovorax sp. JS42 7 2
Comamonas testosteroni KF-1 7 2
Delftia acidovorans SPH-1 7 2
Polaromonas naphthalenivorans CJ2 5 2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236 2 2
Variovorax paradoxus S110 3 2
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntK
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -109
score = 6.07601
sequence = CTAGGATAGCGCTATCTTGC

Gene: Aave_2797: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Acidovorax sp. JS42

Site:
position = -180
score = 6.04656
sequence = TTAAGATAGCGCTATCTTTC

Gene: Ajs_2053: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Comamonas testosteroni KF-1

Site:
position = -21
score = 6.34252
sequence = ATCGGATAGCGCTATCCAAA

Site:
position = -147
score = 6.01302
sequence = TTATGATAGCGCTATCCGGA

Gene: CtesDRAFT_0561: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Delftia acidovorans SPH-1

Site:
position = -120
score = 6.27531
sequence = TTATGATAGCGCTATCCCAA

Gene: Daci_3761: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -140
score = 6.46716
sequence = ATAGGATAGCGCTATCCCAA

Site:
position = -30
score = 6.10489
sequence = AACGGATAGCGCTATCCAAG

Gene: Pnap_0046: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Polaromonas sp. JS666
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -33
score = 6.05178
sequence = TTAAGATAGCGCTATCTATT

Gene: Rfer_0956: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
*
Leptothrix cholodnii SP-6

Site:
position = -128
score = 6.55702
sequence = CTAGGATAGCGCTATCCAAA

Site:
position = -19
score = 6.01059
sequence = ACGAGATAGCGCTATCCAAA

Gene: Lcho_0327: Thermoresistant gluconokinase (EC 2.7.1.12)
Thermoresistant gluconokinase (EC 2.7.1.12)
gntY
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2796: Predicted gluconate TRAP family transporter, DctQ subunit
 
Acidovorax sp. JS42

Gene: Ajs_2052: Predicted gluconate TRAP family transporter, DctQ subunit
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0560: Predicted gluconate TRAP family transporter, DctQ subunit
 
Delftia acidovorans SPH-1

Gene: Daci_3762: Predicted gluconate TRAP family transporter, DctQ subunit
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0045: Predicted gluconate TRAP family transporter, DctQ subunit
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2795: Predicted gluconate TRAP family transporter, DctM subunit
 
Acidovorax sp. JS42

Gene: Ajs_2051: Predicted gluconate TRAP family transporter, DctM subunit
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0559: Predicted gluconate TRAP family transporter, DctM subunit
 
Delftia acidovorans SPH-1

Gene: Daci_3763: Predicted gluconate TRAP family transporter, DctM subunit
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0044: Predicted gluconate TRAP family transporter, DctM subunit
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Predicted gluconate TRAP family transporter, DctM subunit
gntX
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2794: Predicted gluconate TRAP family transporter, DctP subunit
 
Acidovorax sp. JS42

Gene: Ajs_2050: Predicted gluconate TRAP family transporter, DctP subunit
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0558: Predicted gluconate TRAP family transporter, DctP subunit
 
Delftia acidovorans SPH-1

Gene: Daci_3764: Predicted gluconate TRAP family transporter, DctP subunit
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0043: Predicted gluconate TRAP family transporter, DctP subunit
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Predicted gluconate TRAP family transporter, DctP subunit
edd
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2793: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Acidovorax sp. JS42

Gene: Ajs_2049: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0557: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Delftia acidovorans SPH-1

Gene: Daci_3765: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2986: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Polaromonas sp. JS666

Gene: Bpro_3551: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2060: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Variovorax paradoxus S110

Gene: Vapar_3708: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2570: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6

Gene: Lcho_2919: 6-phosphogluconate dehydratase (EC 4.2.1.12)
6-phosphogluconate dehydratase (EC 4.2.1.12)
eda
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_2792: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Acidovorax sp. JS42

Gene: Ajs_2048: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0556: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Delftia acidovorans SPH-1

Gene: Daci_3766: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_2985: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Polaromonas sp. JS666

Gene: Bpro_3550: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2061: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Variovorax paradoxus S110

Gene: Vapar_3707: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2569: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6

Gene: Lcho_2918: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
CRON 2.
gntT
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -66
score = 5.77646
sequence = GCGGGATAGCGCTATCCCTG

Site:
position = -141
score = 6.10389
sequence = CTAGGATAGCGCTGTCCCAG

Site:
position = -157
score = 5.7446
sequence = ATTGGACAGCGCTGTCCTAG

Gene: Vapar_6142: High-affinity H+/gluconate symporter
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
High-affinity H+/gluconate symporter
gntK3
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_6143: Gluconokinase, Firmicutes type (EC 2.7.1.12)
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Gluconokinase, Firmicutes type (EC 2.7.1.12)
 
CRON 3.
gntR
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -55
score = 6.07601
sequence = GCAAGATAGCGCTATCCTAG

Site:
position = -172
score = 6.10489
sequence = CTTGGATAGCGCTATCCGTT

Gene: Aave_2798: Gluconate utilization transcriptional regulator GntR, LacI family
*
Acidovorax sp. JS42

Site:
position = -55
score = 6.04656
sequence = GAAAGATAGCGCTATCTTAA

Site:
position = -219
score = 6.02303
sequence = TCAAGATAGCGCTATCTTTA

Gene: Ajs_2054: Gluconate utilization transcriptional regulator GntR, LacI family
*
Comamonas testosteroni KF-1

Site:
position = -181
score = 6.34252
sequence = TTTGGATAGCGCTATCCGAT

Site:
position = -55
score = 6.01302
sequence = TCCGGATAGCGCTATCATAA

Gene: CtesDRAFT_0562: Gluconate utilization transcriptional regulator GntR, LacI family
*
Delftia acidovorans SPH-1

Site:
position = -175
score = 6.24875
sequence = TTGGGATAGCGCTATCCATG

Site:
position = -56
score = 6.27531
sequence = TTGGGATAGCGCTATCATAA

Gene: Daci_3760: Gluconate utilization transcriptional regulator GntR, LacI family
*
Polaromonas naphthalenivorans CJ2

Site:
position = -128
score = 6.10489
sequence = CTTGGATAGCGCTATCCGTT

Gene: Pnap_0047: Gluconate utilization transcriptional regulator GntR, LacI family
 
Polaromonas sp. JS666
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -197
score = 6.05178
sequence = AATAGATAGCGCTATCTTAA

Gene: Rfer_0957: Gluconate utilization transcriptional regulator GntR, LacI family
*
Variovorax paradoxus S110

Site:
position = -70
score = 6.10389
sequence = CTGGGACAGCGCTATCCTAG

Site:
position = -54
score = 5.7446
sequence = CTAGGACAGCGCTGTCCAAT

Site:
position = -145
score = 5.77646
sequence = CAGGGATAGCGCTATCCCGC

Gene: Vapar_6141: Gluconate utilization transcriptional regulator GntR, LacI family
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
*
Leptothrix cholodnii SP-6

Site:
position = -170
score = 6.01059
sequence = TTTGGATAGCGCTATCTCGT

Site:
position = -61
score = 6.55702
sequence = TTTGGATAGCGCTATCCTAG

Gene: Lcho_0328: Gluconate utilization transcriptional regulator GntR, LacI family
Gluconate utilization transcriptional regulator GntR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD