Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia pseudomallei K96243
Burkholderia mallei ATCC 23344
Burkholderia sp. 383
Burkholderia cepacia AMMD
Burkholderia vietnamiensis G4
Burkholderia glumae BGR1
Burkholderia xenovorans LB400
Burkholderia phymatum STM815 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntR
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
*
Burkholderia phymatum STM815

Site:
position = -27
score = 6.21942
sequence = TTGAGACAGCGCTATCCTAA

Site:
position = -129
score = 6.73082
sequence = CCGAGACAGCGCTGTCTCAG

Gene: Bphy_5547: Gluconate utilization transcriptional regulator GntR, LacI family
Gluconate utilization transcriptional regulator GntR, LacI family
 
CRON 2.
gntK
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
*
Burkholderia phymatum STM815

Site:
position = -35
score = 6.73082
sequence = CTGAGACAGCGCTGTCTCGG

Site:
position = -137
score = 6.21942
sequence = TTAGGATAGCGCTGTCTCAA

Gene: Bphy_5548: Thermoresistant gluconokinase (EC 2.7.1.12)
Thermoresistant gluconokinase (EC 2.7.1.12)
gntP
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815

Gene: Bphy_5549: Predicted gluconate permease
Predicted gluconate permease
gntO
 
Burkholderia pseudomallei K96243
 
Burkholderia mallei ATCC 23344
 
Burkholderia sp. 383
 
Burkholderia cepacia AMMD
 
Burkholderia vietnamiensis G4
 
Burkholderia glumae BGR1
 
Burkholderia xenovorans LB400
 
Burkholderia phymatum STM815

Gene: Bphy_5550: Predicted gluconate specific outer membrane porin
Predicted gluconate specific outer membrane porin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD