Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 3 3
Pseudomonas entomophila L48 3 3
Pseudomonas putida KT2440 3 3
Pseudomonas syringae pv. tomato str. DC3000 3 3
Pseudomonas fluorescens Pf-5 3 3
Pseudomonas mendocina ymp 4 1
Pseudomonas stutzeri A1501 4 1
Azotobacter vinelandii AvOP 4 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntKZ
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -67
score = 4.52842
sequence = TTTGGATAGCGCTAACATCC

Gene: Pmen_2569: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion
*
Pseudomonas stutzeri A1501

Site:
position = -104
score = 4.46828
sequence = GTTTGATAGCGCTAACATCC

Gene: PST_2201: Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion
 
Azotobacter vinelandii AvOP
Thermoresistant gluconokinase (EC 2.7.1.12) / Predicted gluconate TRAP family transporter DctM subunit fusion
gntY
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_2568: Predicted gluconate TRAP family transporter, DctQ subunit
 
Pseudomonas stutzeri A1501

Gene: PST_2200: Predicted gluconate TRAP family transporter, DctQ subunit
 
Azotobacter vinelandii AvOP
Predicted gluconate TRAP family transporter, DctQ subunit
gntX
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_2567: Predicted gluconate TRAP family transporter, DctP subunit
 
Pseudomonas stutzeri A1501

Gene: PST_2199: Predicted gluconate TRAP family transporter, DctP subunit
 
Azotobacter vinelandii AvOP
Predicted gluconate TRAP family transporter, DctP subunit
gntR
*
Pseudomonas aeruginosa PAO1

Site:
position = -52
score = 5.85537
sequence = GCGAGACAGCGCTACCTTAG

Site:
position = -180
score = 6.02369
sequence = GTGAGACAGCGCTATCTTTG

Gene: PA2320: Gluconate utilization transcriptional regulator GntR, LacI family
*
Pseudomonas entomophila L48

Site:
position = -192
score = 6.03374
sequence = GTGAGATAGCGCTGTCTTGG

Site:
position = -62
score = 5.98969
sequence = CTGAGACAGCGCTACCTTAG

Gene: PSEEN2422: Gluconate utilization transcriptional regulator GntR, LacI family
*
Pseudomonas putida KT2440

Site:
position = -191
score = 5.88748
sequence = GTGAGATAGCGCTGTCTCGC

Site:
position = -62
score = 5.98969
sequence = CTGAGACAGCGCTACCTTAG

Gene: PP3415: Gluconate utilization transcriptional regulator GntR, LacI family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -229
score = 5.76186
sequence = TGGAGACAGCGCTGTCTTTG

Site:
position = -65
score = 5.7255
sequence = ATGAGACAGCGCTACCTTAT

Gene: PSPTO3563: Gluconate utilization transcriptional regulator GntR, LacI family
*
Pseudomonas fluorescens Pf-5

Site:
position = -201
score = 5.47468
sequence = CGCAGACAGCGCTACCTTCG

Site:
position = -50
score = 5.6091
sequence = TCAGGACAGCGCTACCTTAG

Gene: PFL_4581: Gluconate utilization transcriptional regulator GntR, LacI family
 
Pseudomonas mendocina ymp

Gene: Pmen_2566: Gluconate utilization transcriptional regulator GntR, LacI family
 
Pseudomonas stutzeri A1501

Gene: PST_2198: Gluconate utilization transcriptional regulator GntR, LacI family
*
Azotobacter vinelandii AvOP

Site:
position = -167
score = 5.45706
sequence = CGAGGACAGCGCTATCCTGT

Gene: Avin_27300: Gluconate utilization transcriptional regulator GntR, LacI family
Gluconate utilization transcriptional regulator GntR, LacI family
gntK
*
Pseudomonas aeruginosa PAO1

Site:
position = -34
score = 6.02369
sequence = CAAAGATAGCGCTGTCTCAC

Site:
position = -162
score = 5.85537
sequence = CTAAGGTAGCGCTGTCTCGC

Gene: PA2321: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Pseudomonas entomophila L48

Site:
position = -166
score = 5.98969
sequence = CTAAGGTAGCGCTGTCTCAG

Site:
position = -36
score = 6.03374
sequence = CCAAGACAGCGCTATCTCAC

Gene: PSEEN2421: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Pseudomonas putida KT2440

Site:
position = -164
score = 5.98969
sequence = CTAAGGTAGCGCTGTCTCAG

Site:
position = -35
score = 5.88748
sequence = GCGAGACAGCGCTATCTCAC

Gene: PP3416: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -238
score = 5.7255
sequence = ATAAGGTAGCGCTGTCTCAT

Site:
position = -74
score = 5.76186
sequence = CAAAGACAGCGCTGTCTCCA

Gene: PSPTO3564: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Pseudomonas fluorescens Pf-5

Site:
position = -185
score = 5.6091
sequence = CTAAGGTAGCGCTGTCCTGA

Site:
position = -34
score = 5.47468
sequence = CGAAGGTAGCGCTGTCTGCG

Gene: PFL_4580: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
*2
Azotobacter vinelandii AvOP

Site:
position = -177
score = 5.45706
sequence = ACAGGATAGCGCTGTCCTCG

Gene: Avin_27310: Thermoresistant gluconokinase (EC 2.7.1.12)

Site:
position = -30
score = 5.53074
sequence = AAAAGATAGCGCTATCTACC

Site:
position = -176
score = 5.87755
sequence = ATAAGATAGCGCTGTCTTTA

Gene: Avin_22480: Thermoresistant gluconokinase (EC 2.7.1.12)
Thermoresistant gluconokinase (EC 2.7.1.12)
 
CRON 2.
gntT
*
Pseudomonas aeruginosa PAO1

Site:
position = -78
score = 5.45145
sequence = CAAAGATAGCGCTACCCCGA

Gene: PA2322: High-affinity H+/gluconate symporter
*
Pseudomonas entomophila L48

Site:
position = -82
score = 5.98191
sequence = CAAAGACAGCGCTGTCTTAA

Gene: PSEEN2420: High-affinity H+/gluconate symporter
*
Pseudomonas putida KT2440

Site:
position = -88
score = 5.50541
sequence = CAAAGACAGCGCTACCCCAA

Gene: PP3417: High-affinity H+/gluconate symporter
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -82
score = 5.87579
sequence = AAAAGACAGCGCTGTCTTGC

Gene: PSPTO3565: High-affinity H+/gluconate symporter
*
Pseudomonas fluorescens Pf-5

Site:
position = -72
score = 5.50875
sequence = AAAAGGTAGCGCTATCCCAC

Gene: PFL_4579: High-affinity H+/gluconate symporter
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
*
Azotobacter vinelandii AvOP

Site:
position = -57
score = 5.88937
sequence = GAAAGATAGCGCTGTCTCGC

Gene: Avin_22470: High-affinity H+/gluconate symporter
High-affinity H+/gluconate symporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD