Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 5 1
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1 5 1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043 3 3
Reinekea sp. MED297
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntU
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -107
score = 6.2674
sequence = GAATGTTACCGGTAACATTC

Site:
position = -40
score = 4.47138
sequence = CCTCGTTGCCGGTCGCGCCT

Gene: Csal_0925: Low-affinity gluconate transporter
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Low-affinity gluconate transporter
 
CRON 2.
gntX
*
Hahella chejuensis KCTC 2396

Site:
position = -129
score = 5.63238
sequence = AAAAGTTACCGGTAACAAAT

Site:
position = -103
score = 5.97956
sequence = GAATGTTACCGGTAACACGC

Gene: HCH_03539: Predicted gluconate TRAP family transporter, DctP subunit
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -123
score = 5.62373
sequence = AAATGTTATCGGTAACATCA

Site:
position = -100
score = 5.65655
sequence = TCTAGTTACCGGTAACATTT

Gene: Mmwyl1_0698: Predicted gluconate TRAP family transporter, DctP subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_18002: Predicted gluconate TRAP family transporter, DctP subunit
 
Alcanivorax borkumensis SK2
Predicted gluconate TRAP family transporter, DctP subunit
gntY
 
Hahella chejuensis KCTC 2396

Gene: HCH_03541: Predicted gluconate TRAP family transporter, DctQ subunit
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0697: Predicted gluconate TRAP family transporter, DctQ subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_17997: Predicted gluconate TRAP family transporter, DctQ subunit
 
Alcanivorax borkumensis SK2
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
 
Hahella chejuensis KCTC 2396

Gene: HCH_03542: Predicted gluconate TRAP family transporter, DctM subunit
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0696: Predicted gluconate TRAP family transporter, DctM subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_17992: Predicted gluconate TRAP family transporter, DctM subunit
 
Alcanivorax borkumensis SK2
Predicted gluconate TRAP family transporter, DctM subunit
gntK
 
Hahella chejuensis KCTC 2396

Gene: HCH_03543: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0695: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -69
score = 4.47138
sequence = AGGCGCGACCGGCAACGAGG

Gene: Csal_0926: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Reinekea sp. MED297

Gene: MED297_17987: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Alcanivorax borkumensis SK2
Thermoresistant gluconokinase (EC 2.7.1.12)
gntR
 
Hahella chejuensis KCTC 2396

Gene: HCH_03544: Gluconate utilization transcriptional regulator GntR, LacI family
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0694: Gluconate utilization transcriptional regulator GntR, LacI family
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -53
score = 5.55038
sequence = GAACGTTACCGCTAACATCG

Gene: Csal_0927: Gluconate utilization transcriptional regulator GntR, LacI family
 
Reinekea sp. MED297

Gene: MED297_17972: Gluconate utilization transcriptional regulator GntR, LacI family
 
Alcanivorax borkumensis SK2
Gluconate utilization transcriptional regulator GntR, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD