Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 9 3
Psychromonas sp. CNPT3
Moritella sp. PE36 3 3
Aeromonas hydrophila subsp. hydrophila ATCC 7966 5 3
Aeromonas salmonicida subsp. salmonicida A449 5 3
Tolumonas auensis DSM 9187 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntX
*
Psychromonas ingrahamii 37

Site:
position = -98
score = 5.99049
sequence = GTAAGTTACCGGTAACATTC

Site:
position = -76
score = 5.19872
sequence = ATCAGTTACCGGTAACCTAT

Gene: Ping_2933: Predicted gluconate TRAP family transporter, DctP subunit
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -67
score = 5.89616
sequence = AATAGTTACCGGTAACATAA

Gene: PE36_03014: Predicted gluconate TRAP family transporter, DctP subunit
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Predicted gluconate TRAP family transporter, DctP subunit
gntY
 
Psychromonas ingrahamii 37

Gene: Ping_2934: Predicted gluconate TRAP family transporter, DctQ subunit
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_03009: Predicted gluconate TRAP family transporter, DctQ subunit
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
 
Psychromonas ingrahamii 37

Gene: Ping_2935: Predicted gluconate TRAP family transporter, DctM subunit
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_03004: Predicted gluconate TRAP family transporter, DctM subunit
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Predicted gluconate TRAP family transporter, DctM subunit
gntK2
 
Psychromonas ingrahamii 37

Gene: Ping_2936: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Thermoresistant gluconokinase (EC 2.7.1.12)
gnd
 
Psychromonas ingrahamii 37

Gene: Ping_2937: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -109
score = 4.69736
sequence = TAACGATAGCGTTAACATTG

Gene: PE36_03034: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
CRON 2.
gntR
*
Psychromonas ingrahamii 37

Site:
position = -21
score = 6.08613
sequence = TTATGTTACAGGTAACATTT

Gene: Ping_2929: Gluconate utilization transcriptional regulator GntR, LacI family
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_03029: Gluconate utilization transcriptional regulator GntR, LacI family
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -35
score = 5.79623
sequence = TAATGTTACGTGTAACATTT

Gene: AHA_0290: Gluconate utilization transcriptional regulator GntR, LacI family
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -35
score = 5.65215
sequence = TAATGTTACGTGTAACATTC

Gene: ASA_4107: Gluconate utilization transcriptional regulator GntR, LacI family
 
Tolumonas auensis DSM 9187

Gene: Tola_0775: Gluconate utilization transcriptional regulator GntR, LacI family
Gluconate utilization transcriptional regulator GntR, LacI family
 
CRON 3.
gntT
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -190
score = 6.36571
sequence = GCACGTTACCGGTAACATGT

Site:
position = -176
score = 6.15468
sequence = ACATGTTACCGGTAACAACA

Gene: AHA_0286: High-affinity H+/gluconate symporter
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -190
score = 5.89335
sequence = GCACGTTACCGGCAACATGT

Site:
position = -176
score = 6.15468
sequence = ACATGTTACCGGTAACAACA

Gene: ASA_4111: High-affinity H+/gluconate symporter
*
Tolumonas auensis DSM 9187

Site:
position = -176
score = 6.39577
sequence = TCATGTTACCGGTAACAAGT

Site:
position = -190
score = 6.16627
sequence = GCATGTTACCGGTATCATGT

Gene: Tola_0779: High-affinity H+/gluconate symporter
High-affinity H+/gluconate symporter
 
CRON 4.
gntK
*
Psychromonas ingrahamii 37

Site:
position = -64
score = 5.60563
sequence = ATATGTTACCCGTAACTTAG

Site:
position = -78
score = 5.02426
sequence = TCAAGTTACGGCTAATATGT

Gene: Ping_2932: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -83
score = 5.15013
sequence = CTGTGTTAACGGTAACATTG

Gene: PE36_03024: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -89
score = 6.15468
sequence = TGTTGTTACCGGTAACATGT

Site:
position = -75
score = 6.36571
sequence = ACATGTTACCGGTAACGTGC

Gene: AHA_0287: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -89
score = 6.15468
sequence = TGTTGTTACCGGTAACATGT

Site:
position = -75
score = 5.89335
sequence = ACATGTTGCCGGTAACGTGC

Gene: ASA_4110: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Tolumonas auensis DSM 9187

Site:
position = -76
score = 6.16627
sequence = ACATGATACCGGTAACATGC

Site:
position = -90
score = 6.39577
sequence = ACTTGTTACCGGTAACATGA

Gene: Tola_0778: Thermoresistant gluconokinase (EC 2.7.1.12)
Thermoresistant gluconokinase (EC 2.7.1.12)
edd
 
Psychromonas ingrahamii 37

Gene: Ping_2931: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0288: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4109: Phosphogluconate dehydratase (EC 4.2.1.12)
 
Tolumonas auensis DSM 9187

Gene: Tola_0777: Phosphogluconate dehydratase (EC 4.2.1.12)
Phosphogluconate dehydratase (EC 4.2.1.12)
eda
 
Psychromonas ingrahamii 37

Gene: Ping_2930: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0289: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4108: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Tolumonas auensis DSM 9187

Gene: Tola_0776: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD