Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125 3 3
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntU
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -83
score = 6.57794
sequence = ACATGTTACGCGTAACTTAA

Site:
position = -97
score = 6.29242
sequence = TTAAGTTACTGGTAACATGT

Gene: PSHAb0479: Low-affinity gluconate transporter
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Low-affinity gluconate transporter
 
CRON 2.
gntR
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -97
score = 6.54137
sequence = TTATGTTACGTGTAACATAA

Gene: PSHAb0478: Gluconate utilization transcriptional regulator GntR, LacI family
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Gluconate utilization transcriptional regulator GntR, LacI family
 
CRON 3.
gntK
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -90
score = 6.57794
sequence = TTAAGTTACGCGTAACATGT

Site:
position = -76
score = 6.29242
sequence = ACATGTTACCAGTAACTTAA

Gene: PSHAb0480: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Thermoresistant gluconokinase (EC 2.7.1.12)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD