Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Haemophilus influenzae Rd KW20
Aggregatibacter aphrophilus NJ8700 2 2
Pasteurella multocida subsp. multocida str. Pm70 2 2
Mannheimia succiniciproducens MBEL55E 5 2
Actinobacillus succinogenes 130Z 4 2
Haemophilus somnus 2336 4 2
Actinobacillus pleuropneumoniae serovar 7 str. AP76 2 2
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntK
 
Haemophilus influenzae Rd KW20
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -195
score = 6.19473
sequence = AAATGTTACTGGTAACATAC

Site:
position = -64
score = 5.89636
sequence = GATTGTTACCGATAACATTT

Gene: NT05HA_1088: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -232
score = 6.15707
sequence = TATTGTTACCAGTAACATAA

Site:
position = -70
score = 5.62489
sequence = TGATGTTACCAGTAACGTTT

Gene: PM0792: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -201
score = 5.64764
sequence = ATTGGTTACTGGTAACATAC

Site:
position = -70
score = 5.50317
sequence = TATTGTTATCGGTAACTGTT

Gene: MS0957: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Actinobacillus succinogenes 130Z

Site:
position = -209
score = 6.08368
sequence = GATTGTTACCAGTAACATAT

Site:
position = -67
score = 6.17209
sequence = AAATGTTACTGGTAACAGAT

Gene: Asuc_1154: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Haemophilus somnus 2336

Site:
position = -227
score = 6.08365
sequence = TTCTGTTACTGGTAACATAT

Site:
position = -75
score = 5.27381
sequence = AAGTGTTATTGGTAACTTTT

Gene: HSM_0704: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -155
score = 6.20717
sequence = AATTGTTACTGGTAACATAA

Site:
position = -66
score = 6.03434
sequence = TAATGTTACCTGTAACATTA

Gene: APP7_1726: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -179
score = 6.25727
sequence = AATTGTTACTGGTAACATAT

Site:
position = -40
score = 5.57588
sequence = TTCAGTTATCGGTAACATTT

Gene: HAPS_1788: Thermoresistant gluconokinase (EC 2.7.1.12)
Thermoresistant gluconokinase (EC 2.7.1.12)
 
CRON 2.
idnD
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -167
score = 5.50317
sequence = AACAGTTACCGATAACAATA

Site:
position = -36
score = 5.64764
sequence = GTATGTTACCAGTAACCAAT

Gene: MS0956: L-idonate 5-dehydrogenase (EC 1.1.1.264)
*
Actinobacillus succinogenes 130Z

Site:
position = -36
score = 6.08368
sequence = ATATGTTACTGGTAACAATC

Site:
position = -178
score = 6.17209
sequence = ATCTGTTACCAGTAACATTT

Gene: Asuc_1155: L-idonate 5-dehydrogenase (EC 1.1.1.264)
*
Haemophilus somnus 2336

Site:
position = -189
score = 5.27381
sequence = AAAAGTTACCAATAACACTT

Site:
position = -37
score = 6.08365
sequence = ATATGTTACCAGTAACAGAA

Gene: HSM_0703: L-idonate 5-dehydrogenase (EC 1.1.1.264)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
L-idonate 5-dehydrogenase (EC 1.1.1.264)
idnO
 
Haemophilus influenzae Rd KW20
 
Aggregatibacter aphrophilus NJ8700
 
Pasteurella multocida subsp. multocida str. Pm70
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0955: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1156: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Haemophilus somnus 2336

Gene: HSM_0702: Gluconate 5-dehydrogenase (EC 1.1.1.69)
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Haemophilus ducreyi 35000HP
 
Haemophilus parasuis SH0165
Gluconate 5-dehydrogenase (EC 1.1.1.69)
gntU
 
Haemophilus influenzae Rd KW20
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -171
score = 5.89636
sequence = AAATGTTATCGGTAACAATC

Site:
position = -40
score = 6.19473
sequence = GTATGTTACCAGTAACATTT

Gene: NT05HA_1087: Low-affinity gluconate transporter
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -202
score = 5.62489
sequence = AAACGTTACTGGTAACATCA

Site:
position = -40
score = 6.15707
sequence = TTATGTTACTGGTAACAATA

Gene: PM0793: Low-affinity gluconate transporter
 2
Mannheimia succiniciproducens MBEL55E

Gene: MS0953: Low-affinity gluconate transporter

Gene: MS0954: Low-affinity gluconate transporter
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1157: Low-affinity gluconate transporter
 
Haemophilus somnus 2336

Gene: HSM_0701: Low-affinity gluconate transporter
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -131
score = 6.03434
sequence = TAATGTTACAGGTAACATTA

Site:
position = -42
score = 6.20717
sequence = TTATGTTACCAGTAACAATT

Gene: APP7_1725: Low-affinity gluconate transporter
 
Haemophilus ducreyi 35000HP
*
Haemophilus parasuis SH0165

Site:
position = -38
score = 6.25727
sequence = ATATGTTACCAGTAACAATT

Site:
position = -177
score = 5.57588
sequence = AAATGTTACCGATAACTGAA

Gene: HAPS_1787: Low-affinity gluconate transporter
Low-affinity gluconate transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD