Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 5 3
Vibrio vulnificus CMCP6 5 3
Vibrio harveyi ATCC BAA-1116 5 3
Vibrio parahaemolyticus RIMD 2210633 4 2
Vibrio shilonii AK1 2 1
Vibrio splendidus LGP32 6 2
Vibrio fischeri ES114
Vibrio salmonicida LFI1238 5 3
Vibrio angustum S14 3 2
Photobacterium profundum SS9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntR
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -40
score = 5.70632
sequence = TAATGTTACTCATAACATTT

Gene: VC0289: Gluconate utilization transcriptional regulator GntR, LacI family
*
Vibrio vulnificus CMCP6

Site:
position = -37
score = 5.74379
sequence = TAATGTTACAAGTAACATTA

Gene: VV1_1098: Gluconate utilization transcriptional regulator GntR, LacI family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -38
score = 5.90614
sequence = TAATGTTACTAGTAACATTA

Gene: VIBHAR_00507: Gluconate utilization transcriptional regulator GntR, LacI family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0058: Gluconate utilization transcriptional regulator GntR, LacI family
 
Vibrio shilonii AK1

Gene: VSAK1_19449: Gluconate utilization transcriptional regulator GntR, LacI family
*
Vibrio splendidus LGP32

Site:
position = -43
score = 5.9175
sequence = CTATGTTACCAGTAACATTA

Gene: VS_II0411: Gluconate utilization transcriptional regulator GntR, LacI family
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -32
score = 5.34993
sequence = ACTTGTTACAAGTAACATTG

Gene: VSAL_II0668: Gluconate utilization transcriptional regulator GntR, LacI family
 
Vibrio angustum S14

Gene: VAS14_06913: Gluconate utilization transcriptional regulator GntR, LacI family
 
Photobacterium profundum SS9
Gluconate utilization transcriptional regulator GntR, LacI family
 
CRON 2.
gntX
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -85
score = 5.53879
sequence = TAAAGTTACCGGTAACATCC

Site:
position = -61
score = 5.75856
sequence = CAACGTTACCGGTAACATAT

Gene: VS_II0405: Predicted gluconate TRAP family transporter, DctP subunit
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Predicted gluconate TRAP family transporter, DctP subunit
gntY
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0406: Predicted gluconate TRAP family transporter, DctQ subunit
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0407: Predicted gluconate TRAP family transporter, DctM subunit
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Predicted gluconate TRAP family transporter, DctM subunit
gntK2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0408: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Thermoresistant gluconokinase (EC 2.7.1.12)
gnd
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II0409: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
CRON 3.
gntU
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -80
score = 6.24715
sequence = TCATGTTATGGGTAACATGT

Site:
position = -66
score = 6.1948
sequence = ACATGTTACCGGTAACTTCA

Gene: VC0286: Low-affinity gluconate transporter
*
Vibrio vulnificus CMCP6

Site:
position = -79
score = 6.45241
sequence = TCATGTTATCGGTAACATGT

Site:
position = -65
score = 6.09493
sequence = ACATGTTACCGGTAACGTAA

Gene: VV1_1101: Low-affinity gluconate transporter
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -80
score = 6.45241
sequence = TCATGTTATCGGTAACATGT

Site:
position = -66
score = 5.93813
sequence = ACATGTTACCGGTAACTAAA

Gene: VIBHAR_00514: Low-affinity gluconate transporter
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -80
score = 6.45241
sequence = TCATGTTATCGGTAACATGT

Site:
position = -66
score = 5.86357
sequence = ACATGTTACCGGTAACTGAA

Gene: VP0064: Low-affinity gluconate transporter
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -87
score = 6.10762
sequence = TTAAGTTACGGGTAACATGT

Site:
position = -73
score = 5.73052
sequence = ACATGTTACCCGTAACTCTT

Gene: VSAL_II0665: Low-affinity gluconate transporter
*
Vibrio angustum S14

Site:
position = -107
score = 6.32528
sequence = CCATGTTACGGGTAACATGT

Site:
position = -93
score = 6.17923
sequence = ACATGTTACCCGTAACATTG

Gene: VAS14_06893: Low-affinity gluconate transporter
 
Photobacterium profundum SS9
Low-affinity gluconate transporter
eda
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0285: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Vibrio vulnificus CMCP6

Gene: VV1_1102: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00515: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0065: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0664: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
Vibrio angustum S14
 
Photobacterium profundum SS9
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
 
CRON 4.
gntK
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -93
score = 6.24715
sequence = ACATGTTACCCATAACATGA

Site:
position = -107
score = 6.1948
sequence = TGAAGTTACCGGTAACATGT

Gene: VC0287: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Vibrio vulnificus CMCP6

Site:
position = -107
score = 6.09493
sequence = TTACGTTACCGGTAACATGT

Site:
position = -93
score = 6.45241
sequence = ACATGTTACCGATAACATGA

Gene: VV1_1100: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -106
score = 5.93813
sequence = TTTAGTTACCGGTAACATGT

Site:
position = -92
score = 6.45241
sequence = ACATGTTACCGATAACATGA

Gene: VIBHAR_00513: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -107
score = 5.86357
sequence = TTCAGTTACCGGTAACATGT

Site:
position = -93
score = 6.45241
sequence = ACATGTTACCGATAACATGA

Gene: VP0063: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Vibrio shilonii AK1

Site:
position = -129
score = 5.92089
sequence = AAAAGTTACCGGTATCATGT

Site:
position = -115
score = 5.94547
sequence = TCATGTTACCAGTAACATCG

Gene: VSAK1_19439: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -92
score = 6.10762
sequence = ACATGTTACCCGTAACTTAA

Site:
position = -106
score = 5.73052
sequence = AAGAGTTACGGGTAACATGT

Gene: VSAL_II0666: Thermoresistant gluconokinase (EC 2.7.1.12)
*
Vibrio angustum S14

Site:
position = -75
score = 6.32528
sequence = ACATGTTACCCGTAACATGG

Site:
position = -89
score = 6.17923
sequence = CAATGTTACGGGTAACATGT

Gene: VAS14_06898: Thermoresistant gluconokinase (EC 2.7.1.12)
 
Photobacterium profundum SS9
Thermoresistant gluconokinase (EC 2.7.1.12)
edd
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0288: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Vibrio vulnificus CMCP6

Gene: VV1_1099: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00512: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0062: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Vibrio shilonii AK1

Gene: VSAK1_19444: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_II0667: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Vibrio angustum S14

Gene: VAS14_06903: 6-phosphogluconate dehydratase (EC 4.2.1.12)
 
Photobacterium profundum SS9
6-phosphogluconate dehydratase (EC 4.2.1.12)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD