Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Desulfuromonadales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 29 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Geobacter metallireducens GS-15 7 3
Geobacter sulfurreducens PCA 7 3
Geobacter uraniumreducens Rf4 7 3
Geobacter sp. FRC-32 7 3
Geobacter sp. M21 7 3
Geobacter lovleyi SZ 8 4
Pelobacter propionicus DSM 2379 8 4
Pelobacter carbinolicus str. DSM 2380 7 3
Desulfuromonas acetoxidans DSM 684 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Geobacter metallireducens GS-15

Site:
position = -81
score = 7.44104
sequence = TTAGCACTCAGCTGTATCGAGTGCTAA

Gene: Gmet_0028: Heat shock protein 60 family co-chaperone GroES
*
Geobacter sulfurreducens PCA

Site:
position = -80
score = 7.40729
sequence = TTAGCACTCAGTCGTATCGAGTGCTAA

Gene: GSU3339: Heat shock protein 60 family co-chaperone GroES
*
Geobacter uraniumreducens Rf4

Site:
position = -85
score = 7.16517
sequence = TTAGCACTCGGCAGCTTGGAGTGCTAA

Gene: Gura_4306: Heat shock protein 60 family co-chaperone GroES
*
Geobacter sp. FRC-32

Site:
position = -81
score = 7.04923
sequence = TTAGCACTCAGCTACAAGGAGTGCTAA

Gene: Geob_0399: Heat shock protein 60 family co-chaperone GroES
*
Geobacter sp. M21

Site:
position = -78
score = 7.56178
sequence = TTAGCACTCAGCAGTTTTGAGTGCTAA

Gene: GM21_0232: Heat shock protein 60 family co-chaperone GroES
*
Geobacter lovleyi SZ

Site:
position = -79
score = 6.88277
sequence = TTAGCACTCACCGCTTTAGAGTGCTAG

Gene: Glov_2928: Heat shock protein 60 family co-chaperone GroES
*
Pelobacter propionicus DSM 2379

Site:
position = -77
score = 7.29604
sequence = TTAGCACTCGGTCATCGTGAGTGCTAA

Gene: Ppro_2803: Heat shock protein 60 family co-chaperone GroES
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -159
score = 7.24253
sequence = TTAGCACTCATGTAAACCGAGTGCTAA

Gene: Pcar_2771: Heat shock protein 60 family co-chaperone GroES
*
Desulfuromonas acetoxidans DSM 684

Site:
position = -105
score = 7.19551
sequence = TTAGCACTCCCTTTTGCTGAGTGCTAA

Gene: Dace_1149: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Geobacter metallireducens GS-15

Gene: Gmet_0029: Heat shock protein 60 family chaperone GroEL
 
Geobacter sulfurreducens PCA

Gene: GSU3340: Heat shock protein 60 family chaperone GroEL
 
Geobacter uraniumreducens Rf4

Gene: Gura_4307: Heat shock protein 60 family chaperone GroEL
 
Geobacter sp. FRC-32

Gene: Geob_0398: Heat shock protein 60 family chaperone GroEL
 
Geobacter sp. M21

Gene: GM21_0233: Heat shock protein 60 family chaperone GroEL
 
Geobacter lovleyi SZ

Gene: Glov_2929: Heat shock protein 60 family chaperone GroEL
 
Pelobacter propionicus DSM 2379

Gene: Ppro_2802: Heat shock protein 60 family chaperone GroEL
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_2770: Heat shock protein 60 family chaperone GroEL
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1148: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
 
CRON 2.
rpoH
*
Geobacter metallireducens GS-15

Site:
position = -64
score = 7.31418
sequence = TTAGCACTCAGACAAACCGAGTGCTAA

Gene: Gmet_2854: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Geobacter sulfurreducens PCA

Site:
position = -52
score = 7.37108
sequence = TTAGCACTCAGACGTACCGAGTGCTAA

Gene: GSU0655: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Geobacter uraniumreducens Rf4

Site:
position = -92
score = 6.79031
sequence = TTAGCACTCTTAACTTGAGAGTGCCAA

Gene: Gura_3950: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Geobacter sp. FRC-32

Site:
position = -58
score = 7.23303
sequence = TTAGCACTCGATTCTGAAGAGTGCTAA

Gene: Geob_0795: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Geobacter sp. M21

Site:
position = -69
score = 6.79368
sequence = TTAGCGCTCACATGGGCAGAGTGCTAA

Gene: GM21_0586: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*2
Geobacter lovleyi SZ

Site:
position = -56
score = 7.05012
sequence = TTAGCAGTCAGCACCATAGAGTGCTAA

Gene: Glov_0181: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Site:
position = -51
score = 6.88374
sequence = TTAGCAGTCTTGTGTGTCGAGTGCTAA

Gene: Glov_1330: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*2
Pelobacter propionicus DSM 2379

Site:
position = -56
score = 6.88181
sequence = TTAGCAGTCACCGCACGAGAGTGCTAA

Gene: Ppro_0114: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Site:
position = -63
score = 6.5616
sequence = TTGGCAGTCGGACGGCTTGAGTGCTAA

Gene: Ppro_0664: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -59
score = 7.12024
sequence = TTAGCACTCGCCATCAACGAGTGCTAA

Gene: Pcar_2382: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Desulfuromonas acetoxidans DSM 684

Site:
position = -63
score = 7.30491
sequence = TTAGCACTCAAGGCAAGAGAGTGCTAA

Gene: Dace_1569: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
CRON 3.
hrcA
*
Geobacter metallireducens GS-15

Site:
position = -46
score = 7.39077
sequence = TTAGCACTCACCAACTCTGAGTGCTAA

Gene: Gmet_3534: Heat shock response transcriptional regulator HrcA, HrcA family
*
Geobacter sulfurreducens PCA

Site:
position = -48
score = 7.3888
sequence = TTAGCACTCACGTCCCTTGAGTGCTAA

Gene: GSU0031: Heat shock response transcriptional regulator HrcA, HrcA family
*
Geobacter uraniumreducens Rf4

Site:
position = -47
score = 7.38005
sequence = TTAGCACTCGAATTCCTTGAGTGCTAA

Gene: Gura_0209: Heat shock response transcriptional regulator HrcA, HrcA family
*
Geobacter sp. FRC-32

Site:
position = -49
score = 7.48133
sequence = TTAGCACTCAAATTCTTTGAGTGCTAA

Gene: Geob_1105: Heat shock response transcriptional regulator HrcA, HrcA family
*
Geobacter sp. M21

Site:
position = -47
score = 7.42478
sequence = TTAGCACTCGAACTTTTTGAGTGCTAA

Gene: GM21_3576: Heat shock response transcriptional regulator HrcA, HrcA family
*
Geobacter lovleyi SZ

Site:
position = -79
score = 7.43848
sequence = TTAGCACTCAAGTTTATAGAGTGCTAA

Gene: Glov_2831: Heat shock response transcriptional regulator HrcA, HrcA family
*
Pelobacter propionicus DSM 2379

Site:
position = -44
score = 6.80092
sequence = TTAGCACTCTCCAGTCATGAGTGCTAT

Gene: Ppro_1406: Heat shock response transcriptional regulator HrcA, HrcA family
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -42
score = 7.38601
sequence = TTAGCACTCAATAAGCTAGAGTGCTAA

Gene: Pcar_0109: Heat shock response transcriptional regulator HrcA, HrcA family
*
Desulfuromonas acetoxidans DSM 684

Site:
position = -86
score = 7.21685
sequence = TTAGCACTCCGGATGTTTGAGTGCTAA

Gene: Dace_0267: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Geobacter metallireducens GS-15

Gene: Gmet_3533: Heat shock protein GrpE
 
Geobacter sulfurreducens PCA

Gene: GSU0032: Heat shock protein GrpE
 
Geobacter uraniumreducens Rf4

Gene: Gura_0210: Heat shock protein GrpE
 
Geobacter sp. FRC-32

Gene: Geob_1106: Heat shock protein GrpE
 
Geobacter sp. M21

Gene: GM21_3575: Heat shock protein GrpE
 
Geobacter lovleyi SZ

Gene: Glov_2830: Heat shock protein GrpE
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1405: Heat shock protein GrpE
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0108: Heat shock protein GrpE
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_0266: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Geobacter metallireducens GS-15

Gene: Gmet_3532: Chaperone protein DnaK
 
Geobacter sulfurreducens PCA

Gene: GSU0033: Chaperone protein DnaK
 
Geobacter uraniumreducens Rf4

Gene: Gura_0211: Chaperone protein DnaK
 
Geobacter sp. FRC-32

Gene: Geob_1107: Chaperone protein DnaK
 
Geobacter sp. M21

Gene: GM21_3574: Chaperone protein DnaK
 
Geobacter lovleyi SZ

Gene: Glov_2829: Chaperone protein DnaK
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1404: Chaperone protein DnaK
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0107: Chaperone protein DnaK
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_0265: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Geobacter metallireducens GS-15

Gene: Gmet_3531: Chaperone protein DnaJ
 
Geobacter sulfurreducens PCA

Gene: GSU0034: Chaperone protein DnaJ
 
Geobacter uraniumreducens Rf4

Gene: Gura_0212: Chaperone protein DnaJ
 
Geobacter sp. FRC-32

Gene: Geob_1108: Chaperone protein DnaJ
 
Geobacter sp. M21

Gene: GM21_3573: Chaperone protein DnaJ
 
Geobacter lovleyi SZ

Gene: Glov_2828: Chaperone protein DnaJ
 
Pelobacter propionicus DSM 2379

Gene: Ppro_1403: Chaperone protein DnaJ
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_0106: Chaperone protein DnaJ
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_0264: Chaperone protein DnaJ
Chaperone protein DnaJ
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD